Gene Name
DFR-B
Gene AC

AB006793

Species
Ipomoea nil (Japanese morning glory)
GeneAlias
dihydroflavonol 4-reductase B
Organism
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicots; asterids; lamiids; Solanales; Convolvulaceae; Ipomoeeae; Ipomoea
Length
16837
Exons Number
6
Introns Number
5
AS Type
I+III+IV+VI
AS factor
As Number
5
PMID
10323224
Fasta Sequence
CTTTTAGGATGATTGGGCATGTGGCTGTCTGCATGTCTTGATCCTTGTCATTCTGACTCTTCCTTGCTTT
TATGTGTCAGTACTGTTTTACATATCATATTGAGAAATCTGAGAGTTTGCGTGACATTTTTTTTGTACCC
CATGATTTGTGTCTCTAACATAGTAAGACCACCTCTTGGTGTCAAGACTGTGCTGGGGAACTTGCATTCA
GTGGTTTAATCTTTATTAATACTCTCTACTTCATCTAATCCAGTTAATGAGAAATCTGCTCGCTTTGTTT
CACCTGAATTTACATGCCAGTTTGGTTCTTTAAATTGTAGAGGTGGAGCCTCAATATGCTGGTGCAAGAA
TAGAGGGAGATGTTGTAACATTAGATTTTGTGAAGAAGATGCTGGATGACTTCAAAAACCAGAAGAACTT
GCATAAGAGGTATGTTTCGTTTGAATGGTGTAATCTTCTCTTTATTTTTGAAACACTCTTAATCTTTCAA
CATTTGCTCTATTTTGACAGGTATGCCTACCAAATAGTACTGCAAACAAGAGAAATGTTGCGAGCACTGC
CCTCCCTTGTTGACATTGTTGTTCCCGAAGGGAAGCACTTCACTGTATGTGGTGATGTACATGGTCAGGT
AATGATATCCTGATGACGGATGCCTTTTTATAGCTTGTAGCTGTTATTTTTATCATTTGCTTGTCCTTTT
TTTTCTCCTCCAGTTTCATTTCACCCCTCTAGAACAAGATTTTACGTCAGCATATGGTATTGACTAAGGC
ATGCATTTATAGAAGGCGTAGAACTATCTGGTGCTTGCTAGTGATGCTCCTACATGCAAGAATAACTAAA
ACAAAAAATTCTTGTTTCTTTAAAAAATTGCTGCTTGGTTCACTGATCTATTTGGAGAAACATAAAGGTT
GATTCCTTTTGTCAGAAAAAAAGAGGGATGTTAGTGGCTTTTAGACGTCTTTAACCTGTAAGCAATTTGA
AGGCGCTGGAACCTTTTTAAAGATCGTGGGCATGTTCCCTTTGTCGTATTTCTCCTTTTCGCCCCTCCCT
AATTAAAGAATATGGTTCCTTTTGAGCTGAAATATTACTGCTATGCCATTTAGTTCGTAAGGCCTATCAT
ACATATCTGAACCGCAGGCCCTTCCTCTTGTACTTCTCTTCCCACTTGTGAAACATCTCAGTCCCCTTCT
TCACTGGAATCTGAGTTTGGATTTGTCTGATGATGCACTCGCCCACCATAAGCCTTTTCTCCCTACTTTA
GGAAGCATTTTCACCTTCCCTTTAACCAGACTAGGACCTTCATATTTGGAATGCACTTTTTTTCCATTCA
AGAGGAATGGTATAAAATAAAAGCTCTTGAACTTTATTGCGTTAGGAGCTGTGAAGGTCTGAAGGAGTCT
GTATTTAGACTCTAAGTATCATGAACCTCCTATCCAGCTTCAATCTTGTGTCTTCTTCAACTTCGATTAA
CACTGGCCTGTTTCCAGAAATCCTCAGAAGCTCTGGCTCAGAACTGAACTGGCAAGGCAACCAGTCTAAT
CCAGACTGTATCCAACACCAACCCTGAGTGTCTGCCCGACCAGTGAGTTACTCCATACTTTTGAAACACC
ATCTTTGCTTGGTCTGATGGCCCGCGCCTCCTTCTGAGAGGAATTTAAGAAACCCCTCTACCTTTGAACG
GTTGACAACCATGTGGATTAACCCACTTCTAGACCAATTTGATCTTCGGTTGTTTTAGGCTCTTCCCCAA
TCAATGTACCAAAAACCTCTATATAAAGTGTTAGCTTTTTCTCACGATACGCCCTCAACCTCCATTCTGC
TATCCCTTGCTTTCTTTATCGGAGTTGCCAGCGGTTGTTAATATGACCAATTTGAGCAGAGTTTTGGATA
ACCCCTTTTACATGTACCCAAGTTTTATGAATGGAATTTTGACTGCTTCTGTCATTGTCAAGCTAACTGG
AGAACTCTTGACCAGAAAAATACGAAAGGGTAAGATTTAGTAAAGTAATTGTTTTTTCTGGTTTAATTAA
GGAGCAAATCCTAAAGAACACTTGTTTGACTTTAGATATGTGCTGCAAGATATATCATTTAGTCCTTTAT
TCTCTCTTTCCTGCTGTTTATATATAGTGATAATACAATTTGCTGGTTCTATTTCTGTGCTTGGCGGAAT
GACTTGCTTCTTTTTGCCAGCTATAAGTCTCTACTGGCTGAACTGTTGTTCATCTTCTAATGTTGCTACA
GTTTTATGACCTCCTAAATATTTTCGAGCTCAATGGGCTTCCATCAGAAGACAATCCGTATCTGTTCAAT
GGTGATTTTGTTGATAGAGGGTCTTTCTCTCTAGAGGTCATATTGACATTATTTGCCTTCAAGTGCATGT
GTCCATCAGGTAGATCGCCTGCTCTTTTCATCTTCAATGTTGCAAGTGTGTTCTTTTATATTATTACTCC
TACCTAGTATTCTTTGGGTGGAACTTGAAGGTTTTCTGGATGCAAGTTTTCCAGTACCCTATTTTTTACC
TTAGTTATCTGTTTGTGTTAGTATTTATTTGCCTTTACTCATTCTAGTTCTATCTCTTTTATTAATTCAT
GCATCAATTATACCTAACAAGTAAGTGAATGTCCTAGTATTGGTTGGGTGGAACTTGAAGGTTTTCTGGA
TGCAAGTCCAGTCCCCTATTTTTTACCTTAGTGATCTGTTTGAGTTAGTATTCATTTGCCTTTACTCATT
TTCTGTTACTATCTCTTTATTTTTAAATTTGTAATTCAATTATACCTAACAAGTTAGTGAATGTCCGTTT
TGGATCCCTTTTAGATGTAAGCTGTTTGATCATTGCTCATTTTCCTTTACTCATTTTCTTTTTCTCTCTC
TTCTTTGTTTGTACATCAATTAGACCTAACAAGAAAATGAATGTCCCTTTTTGGTCACTTTTCGATGTAA
GCTGTTTGAGTCATTTTTCTTTTTCCATTTCCTATTTCTATTCTTTTTTATTTGTACATCAATTAGACCT
AACAGTGAATGTTCCTTTTGGGTCCCATTTAGATCTAAGTGGTGTGTTAATGCTTTTATTTGAGATTCTG
ATATTGCAATATATCAATCTCTAATCAAAGCTAAGATTTTGATTCCTTCTATACTAGCACGACCTAAAAA
GTAGCGTGTTTTATTTTTCTTCCAATTATTCAGTCGGTGTGTAGATGTTGTTCAGATGGGTCAATTGTAT
CTTGCTAACAACTTTAGTTTTTCAGCTATACACCTGGCGAGAGGAAATCACGAAAGCAAGAGCATGAACA
AAATATATGGGTTTGAGGGCGAGGTCAGATCCAAGTTAAGTGAAATATTTGTGGAACTCTTTGCAGAAGT
GTTCTGTTGCTTACCTTTGGCCCATGTCATAAATGAGAAAGTCTTTGTAGTACATGGAGGTCTTTTTAGT
GTTGATGGCGTGAAGCTCTCTGATATTAGAGCAATTGATCGGTTTTGTGAGCCCCCAGAAGAGGGTAAGT
TCTGATGCAAGTAGAGAATTGTACATGTATGATGTCCTTTCAATATGCTATATCTATACTAATTATTCTG
CTTTAAGCTTCTTAATGCTCCATTAATCGTCTGATAAACTCTTCAAACAAAGCTCGGAAAAACTATTCAT
GCAAGTTTGTGTATCAGAACTACCATTCTCATTTGCTCGGTAGTTATCATCATTACACATTATTTCTGCA
AGCCACTTTCTTGATACATGCTAATAAATACTTTTGAGTCCAGACACGACTATTATTTTGAAATAAAGGC
AACTATTCTGGTCTTTATCGATGCTTTTGTTGGCCAAACAAATTGAAACTTTCTGCATTTCTGCTTGATC
TCAGTTAGTATTAATGTATTGACTTACTTCTTTGATAAGTCATCATCAGTTTTCTGACTTATTAAATATA
TGTTGCTTATTTCTTTTTTACCTTGGTCGTACATAATAAACATCACCAAGTTGTTTAGGACCTTAGGTTT
CATTTGATCTCTTTCAGGGTTAATGTGTGAATTGTTGTGGAGTGATCCACAACCTCAGCCTGGTAGAGGA
CCTAGTAAACGAGGTGTTGGTCTTTCTTTCGGGGGAGACGTAACTAAAAGATTCTTGCAGGAAAATAATC
TAGGTACTAATCTTTTTCTTTCTCCCTTATTCTGTTGTTTGACCATGTAGAGAATTGACATTTCACTGTC
TATTTTTATTCACTTAATGGATTTTAGCACAAATATTTGATGTTGACATGTGTGGGTGCTTGCAGATTTA
GTGGTGCGATCTCATGAAGTGAAGGATGAAGGTTATGAGATTGAGCATGACGGCAAACTCATAACGGTGT
TTTCCGCTCCCAATTATTGTGACCAGGTAATTTGTCTCTATGTATTCCCCTCTCAAGAGTTTATTTGAGC
TCATCCTACTTTAGTTCAATTAAAATCTCAATTTGCAAGTCAAAAGAACACCTTTGCCTCAAAAGTCCCT
CTAGGTTGAAATGTAGCTCTTCATCAAAATCACTGCAGAGTTTTCGGTGTGTATAGATCTTGTATATCTG
TGATTTGTCGGCACTGTTGTTAAAGGCGTGCTGAAGCGAGGCTCAATACTTGTTGAGCGATTCGCCTCGC
CTCGCCTCAATGTCGTCATCAAGGTTCTACGACATGCTTTTCCTTGCGAATGAGCCTCTTCCGAAGAGGC
GAGACAGTTGGCATTTCACTTTATCGTAATCTTTTTGTTCATATATTTGTCATTCATGCTATAACTATTA
GTCTTGGACTATATATATATATATATATATTGTTTCTCCCTTTGTGCTTTTTCTTCATTAAAGTTTATGC
TTTATTTGAGCTTGAAGTCCCAACGGATCTTAGAGGTTTTTTGCTTTTAATGACACTGTTTATCGGTCAA
GTTTAGTATTGACACAACTTGTAGTCCGTTGCTTCATTTAGTATTTTAAAATGATGGGAAATAATGACTT
TCTGCTTCAAGGTAGATTTGGAATTTGTTAGATGTTGACTTTGTCAGTAACTTCGATAGATGGTGTTGTG
GACATATTTGCACAGATGGCGTGGTGTCCAGTTTCATTGCAAGTCTTGTTTCTTAGCATCTAATATATTT
TCAAGTACATAAACTGATTGCAATATGTACAGATATAGTCATAATATTTGCTACTTTTTTGTGACAATTT
ACGTGGACAAGTCAGTTTTATAGTAACTGGAACTGTGTTATCTATACATTTGTATTCCTGTAGTAGAGAA
GGATCTTGTAATAATTTCTTTGTATGACTAATACACTGTTATATCCTATATGAAGTTTCTTTGATGTGAA
TGGAAATGTTTTATTCAATATCCTCAAATGCACTTCGCTGGTTGCAGATGGGTAACAAGGGTGCTTTTAT
ACGATTTGAGGCTCCCGATATGAAGCCAAATATTGTGACATTTTCAGCAGTGGTTAGTGACTTTTATCTT
GAAATGACCTTTTACTCCTTGATAATTAACACTTTTATTCTCATCTCCTTTAATGGGTTGCCTCATGAGT
TGTTTTTACCATGTTATCATCATAACACTGTAGATTAACTCTTGTCATCTTCATTGCGTTGCCTCGTATG
CAGCCACATCCTGATGTCAAACCAATGGCATATGCCAACAACTTCCTTCGCATGTTTTCTTAAAAACTCT
GGAACCTAACGTTCAGTATTACAATCGATGCGACCTTTTGTCTGACTGACCAAGAGCATACACATCAGGA
GGCAAAAGAGCTAGTACTTACAGCCAATTAGCTGCAGTGTCATTATTCGGACAACTTCCTGACTTGCCCG
CAGCATGTGAGGATCCTCACCTCCTTTGTTTTGATTAAGGCGTAAACACTTTCTCTACGATAACAATGTC
GTGTGGTGGATTGTCCTCTGTATTATTTATATTCCTCTTTGTAAGATTGTTACACTTCTCATTTCTTTTA
GAATGTTCAAATTGGGAAAAGCTTTGATAAGTCGAATTTTGGTTTTTTCTATTTTCTTAGTTAAAATAGT
CTATAATTTTTTCCCCACCCAATCAGCCAAGTGTTACTGTTACGATGTCTATTTTACCATTGGATTGTCG
TTTGTCTGTGCCTGTGGCCAGATTACTGGTGTTTCCTACTGATTTTGTTTCGTTATTAATAATGCTTAAC
AGCTTCTAATGAGTCGATGCAAATCCTATCAATTTGTAAAGTTTGTACCATTTAAACGTAAAACTTATGG
GTCATTCCGTAGGATTTACAAAAATAGTGTTAAAAGTTATAATTAGTTATGTTTATATTTCTTACGAAGT
GATTTATATAATATATATATATATGTGTGTGGGGAAAAGTTTTGAGCAGCTACTTTGTCTTTAATCATGC
TAATGCGTACATTAAAATTTTTGCTTTACTAATAACATGAATTC

>gi|37538061|gb|AY341862.1| Hordeum vulgare subsp. vulgare CTD-phosphatase-like protein (Cpl1) gene, complete cds; alternatively spliced
TCCTCTCCCCTCTTGTGATTCCGGTGCGTCTTCCCCTCCTCTCTGCCTGCCTGCGCGCACCGGTCTCCCC
CCCCCCCCCCTCCTCTCTTCCTCCGTCCGCCTCCGCCTCCGGGAGAGGCCGAGAGAGAGGGAGAGAGGGA
GGACGCGCCGGAGCTACCCGCGCCAGCATCGCCTCGGTAAGCTCCGCGGAATTCCTCTCCTGGATTCGCC
CCGGCGCGGTTAGGGATGGATGTTTAGCGGCTGGCAGTAGCTCTGCTCGATTCGGTAGGAATTCGTCTTC
GTATAGCGTGCTGGGGGCTCGTCTCGAGTTTTCGGCTCGCGGACGCCGCGGGGGTTGATTCCCGCGCCCT
CTCCTGGCCGGGGGGTTTGGGTTTTGGTCGATTTTTCGGGAAGTAAGTTGGGGAATTTGAAGCGCCCGGT
CCTAAATCCGACTAGAAACACGCGAGATTTTGATTCTTCCGCACTCGCTAGAGTACGATAGTTGGCGATG
CTTGTCTGGAAACCCTTCCACCTTCCTTCTGGTTGGGGATTTCTATTTTTTCTTCCGTCGGGTTGGACTC
TGCTGCTTTGCTTTCGCTACCTTGGCACTAGTTCTTTCTGCCGGAATCGCACCCAGCTTGCAATTTCTAG
CTAAATCTCTAATTCCACTCGACAGTTTGTCGGGTTCTAATGCACGGCGGCGATCTGAGTGTTTTCAAGT
CACTACTTGTAGGGTTTGCTTGTTGTAATTTCAGTTTTTTCAGCTGTTCTTTGGTTACCCCCTTCAATTG
GAGTAGTGGGAACATCCCTCCAGTCAAAGAAATAATTTTATGGAAATATTTCCCTCCGTCTAAATTTACT
TGTTCTTCTCCTTTTGGGTTTGGGTTCTCGTTTTAGTTTACGCCWTCTTACCTTGTTGTTGCTTAACYTA
GATGTTTTGCTGCCTTTGTAGATCCGTGTTGTACTCCTTGACCGACTATGGCTTTTATCAATTCAAAGTC
AGATTCATTCCAAGCCTTCCGTCTAAAACATAACTTAGGTATTGGATGCCCTTTGTTATTTTGCTAGAGC
CTTTTTCCGTCGACCTAGCTCCAAAAGTAATTCTTTTGCTGTAGTATATGTTGGCAACACAGATGATTTT
GTCCTGAAATCTCTTATTCTCATGCATCCTTTTTTCTTACCTTTGATGCTTCTCAACATTAGTAATTAAT
ACTAGAACACAAGTACGTTACACTTCTAGGTTTATGTGTTTGCTTGTGCAAACTGTGTGAGACGGCAACT
CAGAGGCAGGACTTTTGGGGTTCTGGTTATGTTATCAATCCTGTCCACAATTGGCACAAGCAATGTTGCA
CAATGCTGAAGGTTTTATGGTGTGGGAAAAATTGCAATGTGCATTAGCCTTTTGGTATTCTCGTATTGTT
TGTACTGAAGATTGTGACAAAAATTGGAAGCACAGGATGCTTTTTATGTTAAATCTGTTTGTTGCGCACA
TATTGTTGGCAATGCTCTATTTGTATGTACTAGGAGGGTAAGTAAAGGGAGAWTTGGAGTGGTACACCAA
TATTAGCTCACCAGAGGACACTGTGCCATGTCTGTGCTGCTTGGGTCACTAACATGCTGTCAGATGAGTA
CTATTGCTGCACATGCATTACTTGAATACTTCCAAGTAACATCAGACCTACGCGCCATCTTAGTATAGTC
ACTGATGAGGTCTGTTTGCTTTAGGTGTGTATATGTCACAGAAGCTCGATGACTCTTTTTTCTTACTTTA
TTCTGCAAAATACCATGGGTTTAGGTTTTTGTTTAATATCAGTACACATTATACACCTTCGTAGTCCATG
CTGAATAAGGAAGGCAGAAGTGTTCTTTCCCCTTTTTCCCAAGTAACCCGACAGGGTAGGTAAAAATGTT
Remark
revised date
2002-02-23