Gene Name
APX2
Gene AC

AB002467

Species
Spinacia oleracea (spinach)
GeneAlias
ApxII;ascorbate peroxidase
Organism
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicots; Caryophyllales; Amaranthaceae; Spinacia
Length
8520
Exons Number
13
Introns Number
12
AS Type
I+V
AS factor
As Number
4
PMID
9396722,9931296
Fasta Sequence
>gi|34303901|tpg|BK001280.1| TPA: Arabidopsis thaliana exportin-t (PAUSED) gene, complete cds
TAAGGGAAGAGAACAGTGAAGGAGAGAAGCTAGCTGACGATACTAATTCAAGGCATTGTTTGACTTGTAT
GCAACAAACCAGGACTGGATTTTGAAATCTCGGTTTTTAGGGTTTTTGTAGTGGGGTTAAGTTAACACAA
TGGATGACCTTGAACAGGCAATAGTAATTAGCTTTGAAACTGGTGCTGTTGATTCGGCTTTAAAGTCTCA
AGCTGTTACTTATTGTCAGCAAATCAAAGAGACTCCTTCTATTTGTAGTATATGTATTGAGAAGTTATGG
TTTTCTAAGCTTGTCCAAGTTCAGTTCTGGTGTTTGCAAACGCTTCAGGATGTTTTAAGGGTTAAATATG
GATCTATGAGCTTGGATGAGCAGAGTTATGTGAGGAAATCAGTGTTTTCAATGGCTTGTTTGGAGGTTAT
TGATAATGAGAATGCTGGTAGAGTTGTGGAAGGACCTCCTTTTGTTAAAAACAAGCTTGCACAGGTTTTG
GCTACTTTGATCTATTATGAGTACCCTTTGATTTGGTCCTCGGTGTTTCTTGATTTCATGCTTCATTTGT
GCAAAGGTGCTGTTGTGATCGACATGTTTTGTCGGGTTTTGAATGCCTTGGACGATGAGTTGATTAGCTT
GGATTACCCCCGGACACCAGAAGAGATATCTGTTGCTGCTCGAGTCAAGGATGCAATGAGGCAACAATGT
GTCCCTCAGATAGCCAGAGCATGGTATGACATTGTATCGATGTACAAGAATTCCGATCCTGATCTTTCTG
CTACTGTGTTAGATTGCATGAGAAGATTTGTATCTTGGATTGACATTGGTTTGGTTGCCAATGATGCATT
TGTTCCACTGCTGTTTGAATTGATTTTGTCTGATGGATTGTCTGAACAAGTCCGCGGTGCAGCAGCTGGG
TGTGTCTTAGCCATGGTTTCTAAGCGGATGGATCCCCAGTCAAAACTGCCCCTTTTGCAGACCCTTCAAA
TCAGTCGTGTTTTTGGTTTAGTATCCGGAGATGTTGATTCCGATTTGGTATCAAAAGTATCTGCTTTGCT
TACTGGCTATGCTGTTGAGGTTCTAGAATGCCATAAGCGTTTGAACTCAGAGGACACCAAGGCAGTCTCC
ATGGATTTGCTGAACGAAGTTCTGCCATCAGTTTTTTATGTCATGCAGAAGTGTGAGGTGGATTCTACTT
TTAGCATCGTCCAGTTTCTCCTGGGTTATGTTTCCACTCTCAAAGGCCTCCCTGCATTGAAGGAGAAGCA
GCTGCTCCACATTACACAGATTCTCGAAGTGATAAGAATTCAGATTTGCTATGATCCTATGTATCGTAAT
AACCTTAATTCACTGGATAAAACTGGATTGGAGGAGGAAGATAGAATGTCCGAGTTTAGAAAAGATCTCT
TTGTCTTATTACGTACAGTGGGCCGTGTTGCTCCTGAAGTTACTCAGCATTTCATTCGTAACTCACTAGC
AAATGCTGTTGAATCTTCATCGGAGAGCAATGTTGAAGAAGTGGAAGCTGCGCTCTCGCTTTTGTATTCA
TTCGGAGAGTCTATGACCGAGGAGGCCATGAAAACAGGATCTGGGTGTTTGAGTGAACTAATTCCGATGC
TCTTGACCACACAGTTCCCTGGTCATTCACATAGACTTGTTGCACTAGTGTACTTAGAAAACATAACAAG
GTACATGAAGTTTATTCAGGAAAACTCCCAGTACATTCCCAATGTTCTTGGTGCTTTCCTTGATGATAGG
GGTTTGCATCACCAGAATTTCTATGTGAGCCGTAGAGCTGGTTACTTGTTCATGAGAGTCGTGAAATTGT
TAAAATCAAAGCTTGTACCATTCATTGACAAGATCTTGCAGGTAAGGGTTTGATTTTCATTTTCTCTTAT
CTACAGCTCGTTTGATCTGAAGGCTAGTTATCCATTTTTGTATATCCGATGTATTTTCTTGTTTAATTTT
TTTGTCTAACTATCTTTTTATGAAAAATCAGAACCTTCAAGATACGTTGTCCCAGTTGACGACTATGAAC
TTTGCATCAAGAGAACTTACTGGAACTGAAGATGGCAGTCACATTTTTGAGGTTTGACTACCACTTGAAG
CTGCTGTTTTCATATATGTACTTCTGCTTGGAAAAAAGGAAATTTTTTCAGTACTCTAAAAAAAATCTCT
CAACTCTAATGCGTTTTTCTGTAGGCTATTGGCATAATCATAGGGTTGGAGGATGTCCCGGCTGAAAAGC
AGTCAGATTATTTGTCTTTACTGCTTACCCCTCTCTGTCAACAGGTTTTCGTTTCTACCATTCTCTTGTT
CATGAAACTTTTTGGCAATAATTATGGTCAGGTGTACTCACACTCTTTCCATGTGATATGATTGTACCAG
ATTGAGGCAGGACTTGTGCAGGCAAAAGTTGCAAGTTCCGAAGACTTTCCTGTGAAAATTGCAAATATCC
AATTTGCTATTGTGGCAATTAATGCGCTCAGCAAGGTTTGTGTTCGTTTATTCTAGTTTCTGCACGTGAG
ATTTGTTACTTGGTACTTCAAATTTTACCCTCTTCTGGGCTTGTCCTTACACTTTTGCTTGCAATTCAGG
GCTTCAACGAACGTCTTGTTACTGCTAGTCGTCCTGGAATTGGTCTCATGTTTAAGCAGGTTTGTAAACA
AGATGGTCTTTTCCCTCTTATGAATCATGTATTGCTTTGCAACCTGTCTTTCAATGCTTTTGTACTTTTT
GCAACTTCAGTTGTTGACTGTAATTCTCTGCCCTAATTGAAACTGCTCTGTATTTACTCTTTACTGACCA
TTGGTAACCTTCTCCGTAATGTAGACACTGGATGTTCTTCTAAGGGTGCTAATTGAATTTCCAAAGGTCG
AGCCTTTGCGGAGTAAGGTATGAGTTTAGTTGTATTTTATTAAGTAGACATATTGTAATCAGTAGTGTTG
CATATTCTTTTCCATTAAGTTATTGATTCACAGGTCAGTGATTAGCTTGTTCCCCTTTTCTGTAGGTCAC
ATCATTCATACACCGTATGGTTGATACCCTTGGATCCGCTGTGTTCCCTTATCTTCCCAAGGCTTTGGAA
CAGCTACTTGCTGACAGTGAGGTAAAACGAAAATTTCAAACCTCCCCTTATTATTCAATGCTCCACTGCT
TTCATTTCCTTTAATTAATATTAAGTTGATCTCCTACGATTCACTTACTTACCTGGGAGTAATATCTACT
AATCAAGATACGTCATTTCGGGCAATGATGCTGCACACTAATTTGATTACTTCTTCAACAAAAAGTCTTA
CTGTGTATGTGTATTGTTGCAGCCAAAGGAAATGGTTGGTTTCATGGTATTACTCAATCAGCTTATCTGC
AAATTCAACAGCGCTCTCCATGATATACTGGAAGAAGTATATCCCGTGGTTGCTGTTAGGATTTTCAATG
TAATTCCAAGAGATGGGCTCCCTTCACGCCCTGGGGCTGTTACTGAGGTATTTCGTTTGATTTTCTTTCT
TAACTCAATTTTATGATCTGCAATTGTAACTTGAGAACCTGCTGATATCGTAGCATCCTTTACATCCAGT
CATATATCCTTTTTTTTTTGGTGTAGGAAATGAGGGAACTGATAGAGCTTCAAAGGATGCTGTATACATT
TCTTCATGTTATAGCCACACACGATCTTTCTTCTGTATTTCTTACGCCGAAAAGTAGGGCGTATCTAGAT
CCTATGATGCAGCTGGTTTTGAATACTTCTTGTAATCACAAGGATATTACCGTACGTAAGGTTTGTAACA
CTTTCCCTTTGGTTGCATATTCATTTAATTTTGATGATCTTTTTCGCTTACTTATTATCCACTTGTTTTA
CTCTTTGCCATAAAAATAGGCGTGCGTGCAGATATTTATAAAGCTTATTAAAGATTGGTGTGCCGAGCCA
TATAGCGAGGAGAAGGTAGGCTTGTTAAATAATTTTTATTAACCTTCTTTTCTTCATGAAAGAAGGACAA
ATGTCATAATCAAGAACTATTTTTGCTTTCAGGTTCCAGGTTTTCAGAATTTCGTGATCGAAGCGTTTGC
AACAAACTGTTGTTTGTACAGTGTGCTAGATAAATCCTTCAATTTCAGTGATGCAAATACGGTAAGCTTA
AGAAACTTCAATTCTCTTTTCATTTTGGAGTTTTATCTGTCCGTTGCAGTTGTATAAACTTCTGAATTGT
TTCCACAACTGACTGGGTTTCTTCCTTCGCTATGCATCGCAGCACGCATTGTTCGGGGAAATCATCACGG
CTCAGAAAGTAATGTATGAAAAATTTGGTAATACGTTTCTCATGCATCTTATGTCGAAAAGTTTCCCATC
AGCACATATTCCACAAGATTTGGCGGAGCAGTATTGCCAAAAGTTGCAGGTTTGTTAAGTTTTACTCCCT
CAAAACGACCATAAGTAGATAAAAAATTATCTCGTCTTGTGCTTAAACATAGTCTCTCCTTTCCGTGTTT
GGTATTCCAGGGCAATGATATCCGAAGCCTCAAGTCATACTACCAGTCCCTTATAGAAAATCTCCGGCTT
CAACAAAACGGGAGTCACGTTTTCAGATAGCATTCGAAATACAGCTAGTTTCATAGAAAGAAAGGTCTCT
CAGGTCAATTCCGCTACGAGCTCTAATGGTTTTACCAAGAAAGCTCTCTTCCTCAATTTTTGTACATGAC
AGGTTTGAAGTCATGTGCTTAATATAATGTTCATCTCTTTACAGGCTTCTCCAGATGTAAATAGTATTTG
TCAATGTCTACTTGAGAGGTGGCAACAAGGTTCGCTTTCACCATCCAGATCAAATTAGATCAAAAGCTTG
AGAGAGATTCATACTGTTGTTGATGTTGGTTCTTCTCAAATCTGCAGTTGTATCTTCTTACACATAATCA
TGTTCTCCGACTCGAACCAAGGGCCTTACAAGTTGTTCCAGTGCACACACACACTCTGAGGCAGATCAGC
TGTTATTTCTTATTGCGCTTTGTTGTGAGATTGTGTCTATAAAGCCCTTCCTTTTTTGGTCCTATCTCCA
AGTTTTGATGGTCTTATAACTCTCTGCAGTCGATGTTTTCTGTTTTTCTTTGTCCATGAAAATACTTTAG
AAAAAAACTATGAGAGATCATAAAAGACAGACACACAAAACAATTTTGGCTGAATTTTGTTTTCCTATTT
TATTCATTTAATTAATATGAAATT

>gi|40806808|gb|AY498859.1| Arabidopsis thaliana microRNA 172a-2 (EAT) precursor RNA, complete sequence
GCACCTCTCACTCCCTTTCTCTAACTAGTCTTGTGTGCACCCATTTATGTGTACGTACTATTATCTCATA
AATAAATATTTTTAAAATTAGATGCATTTATTGATATGAAAAAGTTACAAGATTAGTTTGTTGTGTGTGA
GACTTTGGATCGACAGATCGAAAAATTAACTAACCGGTCAGTATTGAATATCAACTATTATATGCTCCAT
GCATTCGCTTATAGTTTCACACAATTTGTTTTCTTCACGGTCTAAAATCAGAAGATTCCATATATTTTCT
TATGACGTAAAAGGACCACTTATAAGTTGACACGTCAGCCCTTGGATTCGTGAGGTTTTTCTCTCTACTT
CACCTATCTACTTTTCCTCATATCCCACTGCTTTTCTCCTTCTTGTTCTTGTTTTTCTCGTTTTTTTCTT
CTTCTTCTCCAAGAAAATAGAGATCGAAAAGATTAGATCTATTTTGTGTAGCAAGAAATTATCATTTTCG
TTTCTTCATTCATATATTGTTCTATTATGTTGTACAATAATAGATACTCGATCTCTTGTGCGTGCGTAAA
TTTTATACAAGTTGTCGGCGGATCCATGGAAGAAAGCTCATCTGTCGTTGTTTGTAGGCGCAGCACCATT
AAGATTCACATGGAAATTGATAAATACCCTAAATTAGGGTTTTGATATGTATATGAGAATCTTGATGATG
CTGCATCAACAATCGACGGCTACAAATACCTAAAGCTTGAGAAAGAAACTTGAAGATATTGATTGAAGTC
TGGATCGATCTTTGGTAAATCTCTCTCTTGATTAGTTTTAAGAATCACTTTTTTTTTTCTGTGTTTGAAC
ATGTTTACATATATCATCTATGTCTCAATATATATATTTTCTTAATCTAGGGTCAATGACGGATTAGGGC
GTTAATTACAATGAATATGGAAAAACTATTTTGCCTTTGATCTTGACTTGAGTGTTGATGAACAGATGTA
TAATGTTATGTAGTATGTACTGTATTTTTTCTAGAATCATTCTTTAGTCTCCAACTCTCCATTAATCAAA
TGAGGTCCTTATAGGTAATGCTATGATCAAGAACAACAAGATCGTGAGCACAGATCGGCCAGTTCGGTCA
CTTTTTAAAAGAGAGATGTTATATTGTTAATTTGTTATTATCAGGTATAATAAATACAGAATAGTTCGTC
CAGAGACCAGACATTTTATAGTTTCAATTTTATGACAGTCTTGTAATAATATTTGTTTAATAGTGTGTCA
CCTTCTATTTCTGGGTTATTACTTGGTCCCGAAATTTTCTTATTGTTCTAATTTTGTAATATTAGAAATT
TGGTTTTCTTGCCAAATCAAATCAAACATTACGGTGTGTTGTACATTGTACCAGAACTTTTGTTTTCAAG
TGCTCAACTTGAGAACC

>gi|33943714|gb|AY266442.1| Hordeum vulgare LINE element Lauren, partial sequence; MLA6-2 (Mla6-2) gene, complete cds, alternatively spliced; Copia/Ty1-like retrotransposon HORPIA-4 and Copia/Ty1-like retrotransposon HORPIA-5, complete sequence
TGGTTTCCGGACGTCGGTGGTCTCCACGAGGTGCAGGTGTATGCGATGGATAGTGGTGCTTCTTCGTCAA
TGGGCAGCTTCGATGGTGGTGATGTTTGTTGGGTTTGCCGACGCCAATGCGGGATGATGTGTGTCTAAGG
TGATGTGGAGCTTGGTGAAAACCATGTCTTGGCCTCGTTCTATGACCATATACGGAACTTTGCTCCAATC
TTAGGTGGGGGATTAGGCCCACCCATCCTGAAAATCAGGAAGGGGTCAGCATTATATTAATGAAAAGGGA
GAGTTAGTACGTAAGATTTTGTAGACTTTTACGTAAGTCTAGCATTATTGTTAACCACCACAGTCCACGT
CATATCACCTTGCTCGATCGTCTCCTCCACAAACTTTTCTTTCCGGCCGTGTGTGGATGATAGTGTGTAC
TCTGTAGCAATTGATTGAAGGATTGGACTGAGTCGACGCTAGTGACCTAAGGGGACCAAGATGCCAGGAA
GGCCGGTCCTATACTCTCTCGTCCATGCATGTCGCGAGCTGCGTCGTCCCCATCACCGCCACTACCACCG
CCATGGTAGGTCTCCACCTTGGTCGACCTCCTCCACAGACTTTTCGCACAAATTAATTCCGGCCAGTCGG
CGACGACCACTTCCCGTGGTGCTGGTGAATGAATTTATGCGTGTGCGTGCTGTGCTTGTCATTCCAGAGA
TATGCCAGTTGCGTTCTCACGGCTGAGTCATCGGCACCTTGCATAGTAGCTCGCTCTACCAGAGACCTTT
GACACCCGTGGATCTAAAAAGTTATTAGTTTTCATGCTTAAGTATCTGATCAATTTGCGGTGTAGTGGCA
TCTTTCTTGCTATTCTGCTCTAATGAAATCTTTCACGTCCACACGTTCTTGTTATAGATCTGCTGATTTG
CTTAGATTATAAGTTCTTCTTATTCTTCCAGATCGATTGAAGCGACCCTCACGCCTCTGGTGCGCCGTCG
CTGTGTTCTGCTCCGCCGTGAAGAATCAAGGTGGGCTTGGTCCAGATCTAGCAAAGCTTTAATTTGGCAG
CTTGTTCAAGGCTTCACACAATTTGGATTGCGTTACAGCTCCCTTTATTCATCAATTTACAGGCTTCCAG
CTGATTGATACGGAGATCTCGTCCTCCTGCTCTCATGGATATTGTCACCGGTGCCATTTCCAACCTGATT
CCCAAGTTGGGGGAGCTGCTCACGGAGGAGTTCAAGCTGCACAAGGGTGTCAAGAAAAATATTGAGGACC
TCGGGAAGGAGCTTGAGAGCATGAACGCTGCCCTCATCAAGATTGGTGAGGTGCCGAGGGAGCAGCTCGA
CAGCCAAGACAAGCTCTGGGCCGATGAGGTCAGAGAGCTCTCCTACGTCATTGAGGATGTCGTCGACAAG
TTCCTCGTACAGGTTGATGGCATTCAGTCTGATGATAACAACAACAAATTTAAGGGGCTCATGAAGAGGA
CGACCGAGTTGTTGAAGAAAGTCAAGCATAAGCATGGGATAGCTCACGCGATCAAGGACATCCAAGAGCA
ACTCCAAAAGGTGGCTGATAGGCGTGACAGGAACAAGGTATTTGTTCCTCATCCTACGAGACCAATTGCT
ATTGACCCTTGCCTTCGAGCTTTGTATGCTGAAGCGACAAAGCTAGTTGGCATATATGGAAAGAGGGATC
AAGACCTCATGAGGTTGCTTTCCATGGAGGGCGATGATGCCTCTAATAAGAGACTGAATGTTAAACGTAG
AGTTTGGGGGAACTGGCTCAACCCTCTAGGGGTGACCTATCACATATATTTACACATGGTGTACCAAGGA
TACGTTACAATATACAAGTGTATATACAGATAACTATACAGTCTAACACCCTCCCTCAATCTTAACTACT
CCCTAAAGAATCTAGGAGAGTAAGATTGCGCCTACAGGCCTTAAACTGTGGTAGAGGCAATGGCTTGGTG
AAGATGTCTGCAAGTTGATCCTTTGAAGAGATGAACTTGATCTGTAATAGCTTCTGGGAAACACGTTCCC
TCACAAAGTGATAGTCAACTTCGATGTGTTTGGTTCGAGCATGGAATACCGGATTCGCTGAGAGGTATGT
AGCACCGATGTTATCACACCAAAGTATAGGAGGCTGCGGTTGTGAAATCCCCAATTCCTGAAGCAAAGAC
TGTACCCATATGAGCTCTGCAGTGGCATTGGCCACAACCTTATATTCAGCTTCAGTACTGCTACGTGACA
CAGTAGCCTGTTTCCGAGCACTCCAGGCGATCAAGTTGGAGCCAAAGAACACAGCATAGCCCCCCGTGGA
TCGCCTATCATCCGGACTCCCAGCCCAATCCGCATCAGAATACGCTGAGAGCACCCCAGTAGGGTTCGGC
CGAAGGTGAAGCCCATGGGACAATGTAAGTCGAACATAGCGCAGGATGTGCTTAACAGCAGACCAATGAA
TGTCACCGGGTGCATGAAGATACTGACAAACTCTGTTGACCGCAAAAGAGATATCTGGTCTCGTGATCAT
CAGATACTGAAGACCACCAACAATACTCCTGTACATAGTAGCATCAGCAGAGGACAGAAGCTCACCATCA
ACAGCAGTGATCTTGTCAGTGGTAGACATAGGGGTAGTTGACATCTTGCACTTAAGCATCCCAGCTCGCT
GCAACAAGTCTAATGAATACTTCTTTTGTGTCATAACAAGACCAGCATCCCTAGGAGCCACTTCCACACC
GAGAAAGTAGTGAAGTCTCCCAAGATCTTTGACAGCAAAATCAGTACCAAGAGCACGAACAAGAGCGTCA
GCAGCAAACTGTGAAGAACTGAGCAGAATGATATCATCTACATAAACCAGCAAGTACATAGTTACCTCAG
GTTTCTGTAGAAGAAATAATGATGAATCAACAGTAGATGGTGCAAAACCATGAGCACGAAGAGCTGTCGC
AAGACGGGCATGCCAGGCACGGGGTGCTTGCTTCAGACCATAGAGTGCTTTGGTAAGACGACATAGATAA
TCAGGATGATCAGGATCAGAAAAACCAGGCGGTTGTCGCATATAAACCTCCTCCTCCAATAAGCCATGAA
GGAAAGCATTCTGCACATCAAGCTGAAAGAGACCAACCTCGAGGAACTGCAAGCGACAGAAGAAGCCTGA
TAGTAGTAGGTTTGACCACAGGGCTGAAAGTGTCCTCATAATCAAGACCATAGCGCTGCCGAAATCCCCT
AGCAACAAGACGCGCTTTGTAGCGCTCAATAGATCCATCAGAATGCTTTTTTACCTTGAAGACCCATTTA
GAATCAATGACGTTGACCCTAGGGGGTGGAGGAGCCAGAGTCCACGTCTCATTGCGAAGAAGAGCGTGAT
ACTCCTGCTCCATAGCGTCTCTCCAATGAGGAATAGTCAGCGCAGCCTGATACGTACACGGTTCCAAGGA
CGGATCCGCAAGAGCAGCAGCCATGCAAGAGGCATACCACACAACAGTACCGTCGGTGCGCTTAAGAGGG
CAGATAACACCATTGCGGCTGCGCGTGTGTGGGCGAGAGGCCACAGGAGCCGACAAGGGGCCAGCCGACG
GTGAGCTGGGCGGCGGTGATGTGGGCCCAGCCGGCGAGGGGCTGGGCGTCGGCGAAGAGGGCCCAGCTAG
CGAAGGGCTGGGCGTCGAGGAAGACGACCCAGCCGGGGAGGGGCTGGGCGGCGGTGAAGACAGCCCAGCC
GGCGATGAGCTGGGCGGCGGTGACGGGTGCCCAGCCGGCGATTGGCTGGACGGCGCCGACAAGCGTAGCG
ACGGTGACGCAGGCGAGGACGGCCGCACGGGCGAGACCGAGCGAGGGCTCACCGGGGGTGGCGTGGGGCG
CGAGGCCAGCGGCAGCAGCCCAGACGCAGGCGAGACCGCTGGTTGCACCGGCGCCGAAGGGGGGTCAACC
GAACCGGCGTCGCCAGGGAACCACAGTCTTCGCGACCGGCAGCAGCCGGTGCCGCTGCAGGCTCGTCCAG
AAGCTCAAGACGAGAACCTCTACCAACACCTGCACCATGGTTAGGTAACAAAATAGGAGCATATGCAACA
TCATCAAATTGGTCAGGGGCAAGAGAGGATGAATGCATAGATGGCGACTCATGGGTGGACACAGGTAAGT
TGGCAAAGGGAAACACATGTTCATCAAACACAACATCCCGAGATATATAGACACGATTTGTGGGAACATG
AAGACATTTGTATCCTTTATGAAGGGAACTATAGCCAAGGAAAACACACTTCTTAGAATGAAACTCGAGC
TTACGTTTATTGTAGGGACGTAAATGTGGCCAGCAAGCACACCCAAACACCTTAAAAAAGGTATAATCGG
GTTGTTCATTAAGAAGGAGTTCCATAGGAGTCTTCATGTCTAAAACACGAGTAGGAGTACGGTTGATGAG
GAAACATGCGGTGGTAAAAGCATCACTCCAAAACCGAAAAGGAACAGAAGCATGGGCCAAAAGAGTAAGA
CCAGTCTCAACAATATGACGATGCTTACGTTCGACAGAACCATTCTGCTGATGTGTATGTGGACATGCTA
AACGATGCGCGATCCCAAGCGAGCTGAAAAAGGAATCAAGGTTGCGATATTCGCCACCCCAATCTAACTG
CACATGAACAATCTTATGCTTGAGAAGGCGTTCAACATGTTTTTGAAATTGAACAACTATATGGAACACA
TCAGATTTACGCTTAAGAAGATAAAGCCAAGTAAAGCGGCTGTAAGCATCAATCAAACTGACATAATAAT
TATGACCACTGGTAGAAGTCTGGGCAGGACCCCATACATCTGAAAAGACAAGTTCAAGAGGATGTTTGAC
CTCACGACTAGATGCTGAAAAAAGGAAGTTGATGACTCTTCCCTTGCTGACAAGCATCACACACTGCTAC
ATCTTTATTACTAGACATGCTAGGAAGCTCATGACAACGCAAAATATGACGGACGATAGGAGTGGCAGGA
TGACCAAGACGAGCATGCCACTATGACGACGAAACACGAACTCCGCTAAAAACCTGAGAGACGCCAGGAT
GCTCCAGACGATAGAGACCCTGGCATAGCCGTCCGCTAAGAAGAACGTCCCTCGTGGCCCGATCCTTAAT
AAAAAGATCAAAGGGGTGAAATTCACAGAGAACATTGTTATCAGCATTAAGCTTAGGAACTGAGAGGAGA
TTACGCGTCACAGCAGGAACGCGAAGAATATTACGAAGTTGAAGACTCCTATTTGGATGGCTAGTGAGAA
GAGATGCTTGACCAATATGAGAGATGCGCATACCTACTCCATTGGCGGTGTGAACCTTGTCGGTGTCGTG
ATAGGCCTCACGAGAGTGGAGCTTGCCGAGCTCGCTGGTGAGGTGATCCGTAGCCCCACTGTCCATGTAC
CGGTGGGGGTCAACGGGATAGGACTGTGTGTGTCCCTGCTGCTCCCGAGGTGCTGGCTTATCAGCCAACT
GCGCCTGATGCTCGTTGTTGCGCGAGTCCTTGCCGTCGTTGTAGAGGCCAAGGAAACTCTTCTGGAAGCG
GCGGTGGCACTTAGAGGCATAGTGACCCGCACGTCCACAGAGCTGGCACTCCCGGGTAGGATGACCCCCC
CCAGAGGATGATGCAGGGGGAGGGGCCAAAAGTAGCGGCGCAATGGGACCGTTGCCCGAGGGGGCCGAGT
GGGCAGCAGAGCCCAAACCCGCCGCGACCCGCGTTGTAGGCGGTGTTTGCCAAGGGAAGACCTCGGCCAC
GAGTGCGGCCTGCCTCCACGCGCTGCTCGGTGAGAAGAAGACGCGAGTAGAGCTCGTGCGCCGGCATCGG
AGACGTGTGGCCACGCTCGTTGATGATCTCCACAAGTCCATCATACTCCTCGTCAAGACCGTTGACGATG
TAGGAGTTGTACTCGGTGTCAGTGAGAGGCTGGCCAATGGAGGCCAGAGTGTCGGCGATGGACTTGACCT
TGTGGTAGAAGGCGGTGGTCGTGCCATCGAGCTTCTCGCACTCACCAAGTTGGCGACGGAGAGCACTGGA
ACGCGCATGCGACTGCGACGCGAAGGAGCGCTCCAGGATAGTCCAGGCCTCATGAGAGGTCTTGGCGAAG
ACGAGCATCCCGGCAACCTGCGGGGTAAGCGACCCCTGGATAGCCGAGAGGTTCGCCTGGTCCTGCCCTG
TCCAGACGCGATGCGCCGGGTTGTAGACGGGTCCATTGACGCTGTCCATGACCGCAGGAGGGCACAGATA
GGAGCCGTCGACGTAGCCGAGGAGGTAATGGCTCCCAAGGAGTGGAAGAACCTGCGCACGCCAGAACACG
TAGTTATCCGAAGATAGCTTGGTGGTGATGAGATGGCCGAACTGGAACGGCGCAGGTAGACTCCCCGGCG
TGAAGACAGCAGGCGGCGTATACGCCGCAGTAGCCGCTGTCACAGGCGCCGGCGCCACATAGGCACCGAG
CGGCGGCGGCGGCTGGGCAGTGTTGGCGTCGAAGTAGGGCTCCATGGCGGGCGTCGTGGCCGGCGGTGTG
GAGGCGGCTACCAGCGGCGCCGAGAGGGCAGCGACCTGAGCAGGCGCCGAGGGGGTCCCCGAGGAGGGAA
CCAACGGCAGCACAAGCACCGGAGGTGGCGACGAGTACGATGCCGCCGAGAAGATGGAGCCGACGCTGAG
GGTGCTGATCGGAGCAGCGACAGCAGCGGCGTCGGTCGGGCGAGAGAGGAGCGCAGCGAGGGAGGCCGGG
AGGAAACCGGCGGAGGCAGAAGCGGTGGCGGTGGTCGTCATCGCAGCGGTCGGAGGGGCGCGGTAGCAGC
GGCGGCTCGGGAGGATGCATCGGCGGCGGCGAACAGAAGATCGCGGCGGCGGCGGCGGCCCGAGGCGGAG
CGACGGCGGCGGCGGCCAGGAGAGATGCGGTGGCGACCTAAAACCCTAACCTAGTCTGATGCCATGTTAA
ACGTAGAGTTTGGGGGAACTGGCTCAACCCTCTAGGGGTGGCCTATCACATATATTTATAGATGGTGTAC
CAAGGGTACGTTACAATATACAAGTGTATATACAGATAACTATACAGTCTAACACTGAAGAAAGATTCGG
AGGGTTGGACAAGACCACTCTTGCTAGAGCAGTATACGAGAAGATTAAAGGTGATTTCGATTGTCGGGCA
TTTGTTCCGGTCGGTCAGAACCCTGACATGAAGAAGGTTTTAAGGGATATCCTCATTGATCTCGGAAATC
TTCACTCAGATCTTGCGATGCTGGATGCCAATCAGCTTATTAAAAAGCTTCATGAATTTCTAGAGAACAA
AAGGTATGCATCAATTTCGAAAAAAGTACACTATTATGTGATGTTTGTTTCCTATGCTAGTGGAACGGAT
TAGAATATTTTTTTCATTAAGGTCACCTTTACTGGCATAAGCAGTTCACACTAAACAGTAAACCTTATAG
GTGAAAAATTTCAGGCATGTATATATATATATGCTATATATGTTTGGTTCTTTCCGGCTTAACAAAATAA
TTAGCAAGTACTTCTTGTTGCATTTGTTCCAACGTCTGAATTTATTGGCATGCATCAGTCCAAGAAATCC
ATCTAGACGTTTTACATTTCACCAAAGTGTGTGTCACGACAGATGTAACAAATAATAAACCAAAAGGAGA
GGAAGGAAAGAGGAAGATAAATGTTACAAAAATTTACATCAAACTTATTTCTTCCTTTCTCCTTACCAAC
CCAGTTGTAAAACACATATTATATTTTAAAGAGAGGCAACATGCGCCAAAGGCTGCCCTTGAAAATTCCT
AAAATATTGTACATTCGACTCATGACCAAACAAAAAGTTAAATTGTCTCTTCCTTATCACATTATATTTC
CATGCATGCCTTTTTCTGGAAACTTACTATCAGCAAAATTTAGACGAAAGGATGATGCCACATAATTTGA
GTCTCCAAGAGATTTGTTAGTCGCCATATATTAAATTGGTGTGCCAATCTATACCTGGGTCTTTTTTATG
TATCTACTTGACCATTTGAACTTCTGTAGTTAATTGTATTCTATGAATGATCACTCATCCAAAAACTTGC
TATTTGTGTTTCACTTTGTTGAGTCTTGAATATTTATTCATTTTGTTCATCATACGATTGGAGGCCCATA
ATGGATGCTTAATGAGAGTAAGATTATCGAGCTCCAAACACATGCTTCTTACTAGTGTTTGAATATATAG
CCTTATAGATGTATAGTTCAACCCATAGATTCATATGACCCTCAGCTTTCTGATGTGTATATATAACCTT
ACACTGATACTCCGAATTAATGTAGGTATCTTGTCATAATTGATGATATATGGGATGAAAAATTGTGGGA
AGGCATCAACTTTGCTTTCTCCAATAGGAATAATCTAGGCAGTCGGCTAATCACCACAACCCGCATTGTT
AGTGTCTCTAATTCATGTTGCTCATCAGATGGTGATTCAGTTTATCAAATGGAACCGCTTTCTGTTGATG
ACTCCAGAATGCTCTTCTACAAAAGAATATTTCCTGATGAGAATGGATGTGTAAATGAATTTGAACAAGT
ATCCAGAGATATTCTAAAGAAATGTGGTGGGTACCACTACCCATAATTACTATAGCTAGTGCTTTGGCTG
GGGACCAGAAGATGAAACCAAAATGTGAGTGGGATATTCTCCTTCAGTCCCTTGGCTCTGGACTAACAGA
AGATAACAGTTTAGAGGAGATGCGGAGAATACTCTCTTTCAGCTATTCTAATCTACCTTCGCATCTGAAA
ACTTGTCTACTGTATCTATGTGTATATCCAGAAGATAGTATGATTTCTAGAGAGAAACTGATATGGAAGT
GGGTGGCTGAAGGATTTTTCCACCATGAAAATCAAGGAAATAGCCTGTATTTGCTCGGATTAAATTACTT
CAACCAGCTCATTAATAGAAGTATGATCCAGCCAATATATAATTATAGCGGCGAGGCATATGCTTGTCGT
GTACATGATATGGTTCTCGACCTTATCTGCAACTTCACATGAAGCAAAGTTTGTTAATCTATTGGATGAC
ACTGGGAACAGCATGTCTTCACAGAGTAATTATTGCCGTCTGTCCATTCAGAACAGAAATGAAGATCATC
AAGCAAAGCCTCTCACAGATATCAAGAGTATGTCACGAGTGAGGTCAATTACTATCTTTCCACCTGCTAT
TGAAGTCATGCCATCTCTTTCAAGGTTTGAGGTTTTATGTGTACTTGATCTGTCGCGATGTAATCTTGGG
GAGAATAGCAGCCTGCAGCTTAACCTCAAGGATGTTGGACATTTAATTCACCTAAGGTACCTTGGTCTAG
CAGGTACCAAAATCAGTAAGCTCCCGGCTGAGGTAGGAAAACTGCAGTTTCTGGAGGTGTTGGATCTTGA
AAACAATCCTTTTCTAAAGGAATTGCCGTCCATTGTTTGTAATTTCAGAAGATTAATCTACCTAAATTTA
TTTGGCTGTCCGGTGGTTCCTCCAGTTGGTGTGTTGCAAAATCTGACATCCATAGAAGTGTTGAGGGACA
TCTTGGTGTCTCTGAACATTATTGCACAAGAGCTTGGCAACCTGGAAAGGCTGAGGGAGCTTGATATTTG
CTTCAGGGATGGTAGTTTGAATTTGTATGAAGGTTTCGTGAAGTCTCTGTGCAACCTACATCACATCGAA
AGTCTACGTATTGAGTGCAATTCCAGAGAAACATCATCTTTTGAACTTATGGATCTCTTGGGAGAACGTT
GGGTGCCTCCTGTACATCTCCGTGAATTTATGTCTTCGATGTCCAGCCAACTCTCTGCACTGCGAGGGTG
GATAAAGAGAGACCCCTCCCATCTCTCGAACCTCTCTAAGTTAATCCTCGGGCGAGTGAAGGAGGTGCAG
CAGGAGGACGTGGAAATCATTGGGGGGCTGTTGTCCCTTCCTTGTCTCTGGATAATAAAGAGCACCCACC
AAACGCAACGGCTGTTGGTCATCCGTGCAGAAGGGTTCCGCTGTATGGTTGACTTTTATTTGGATTGTGG
ATCTGGCACGCAGATATTGTTTGAGCCTGGAGCTTTGCCGAGGGCGGAATCAGTTGTGATCAGTCTCGGC
GTGCGGGTGGCCAAAGAGGATGGTAATGTAGAAGTTAATCATGTTGTTTTTTTAGGATTAGGAAAGAAAG
CCAAACCGAGTCCTAGTAGTATTAGGATTCCTAGTCCTAGTCTATTTCCATAGTCCCTTGTGGACGTGTA
TAAAAGACACCCTAGGGGTTTTGATTGTAACACCAGAAAAACGAAAAGCAATACAAAGCAAAGGCTCGAC
ACGGGCCTTTAGCCATCAAATCCATCGATCAGTTTTATTCGTGTCGCTAGTTACGCAAGTTCCGTCAAGT
AGCCGGCCGAAGCAAGAATCGCGTAGGCACGCCTGTACAGCTGCATATGCACGTTCAAAAGCCAACAATT
GGTATTCAGAGCCTCGACGATCTACGATCTACGATGACGGACAGCGACGCTGAGTCGGTCAAGTCTGGCA
AAGGCGGTCCGAAGGCGAACAAGAACGGCGACAAGGTGAAGAAGGGCGTCAAGTCAGCAGCCAGTGGTGG
AGGAACGAGCGGCGTCAACGTCCAGGCGCATCGCAACATCCCCATCCAGTACCCGATGCTCACCAACACC
AACTATGGCGTGTGGGCGGTGAAGATGAAGATTATTCTCCGAACCCTTCGAGTGTGGCAGGAAATCACGG
ACGACGACGTCGATGACGAGTCCGACGAAGGTGCCATGGCCACCATAGCCCAGTCCGTGCCGGATTCCGT
GCCGCATTCCGTGCTAATGACATTGGCGCAGTTCGAGACGGCAAGAGAGGCGTGGAACACACTCAAGGAG
ATGAGGATCGGAGAAGATCGCGTCACCAAGGCTCAGGCACAAGTGCTGAAGCGCCAATTTCACAAGTTGC
AGATGGAGGAAACTAAATCGGTGAACGACTATGCCATGGGTCTTACTACTTTGGTGGGAGAGATCCGCGC
GCTTGGTGCAAAGCTCGAGGAGACCGAGATTGTGGAGAAATTTTTCAGTTCAGTGACTGACAAATTCACG
TACATCATCGGCACGCTCGAGCAGCTTTACGACATCGACGACATGACCATAACGGAGGCGATCGGACGCC
TGCGGACGTGGGAAGAGAATGCTCGTGGCTGTCGAAAAGGCAAAGGAGGAGGTAGTGACCAACTGATGTA
CTCGCACGCAGATTGGGAGGCCCCAAGTAGCAAAGGAAGGCGTGACGGTGGTGAAGGCTCAAGCAACACG
AAGGGCGATGGACAAACCGGAAAAGGCAAAGGAAAAGGCAAACCACAAGGTCGTGGTAAGGCGGGCCAAT
CTAAAGAGCAGAAACCACGGAACTTGGACTTGTCCGAGGTCAAGTGCTATAACTGCAATAAGATGGGTCA
CTTTGCGAAGGATTGTCCGAAGCCTGACAAGCGGGAGATCAAGGAAAATTTGGCAAAGGAGGAAGACGAA
GGTCCAGGTCTTCTGATGGTCGAAGTTTGTGATCTCGCTGAAACAGTGGTTGTGAAACCAAGCCGGAAGG
TGCTACTTCATGAGAAGAATGTGACACCTAAGTTATCCGGGGATCACAACGTGTCGTGGTATCTCGACAC
GGGTGCCAGTAACCACATGACGGGATGCAAGGAGAAATTTCTCGAGCTGGAATATGATGTTGAAGGCTCG
GTCAAGTTTGGTGATGGTTCAAATGTGGAGATTTGTGGGCAAGGATCTGTCCTCTTCGAGGGTCTCACAG
GCGAACATCGCATACTCACCGGAGTGTACTACATCCCACGGCTTCGCAACAACATCATCTCTATCGGGAA
GCTTGACGAGAATGGATGCAAGGTGGATATCGAGAACGGAGTGATGGCGATCTTCGACAACCTCCGGAAC
ATGCTAACTCATGTTAGTCGCACACGGAACAGGCTCTATATCCTCAACCTTGATCAATCTCAACCGGAGT
GTTGGCTCGCCAAGAGTGATGATGATTCGTGGTTATGGCATGCTAGATTTGGACACGTTAACTTCTACGC
CTTGAAGAAGATGTCAAAGATGGAGATGGTATCCGGCATGCCAGTTATCGACCATGTTGATCGAGTATGT
GACGGGTGCTTGGTTGGAAAACAACACCGCAGGCCATTCCCTGCTCAGTCTACCTATCGTGCAAGTGATG
CACTCGAGCTGCTCCATGGTGATCTATGTGGCGCTATCACCCCGGCAACTCACGCTGGAAAGAAGTATTT
CTTCCTTGTGGTAGACGACTACTCGAGATATATGTGGGTCATTCTCCTACGATCTAAAGATGAGGCGTTT
GAAGCGTCCAAGAAGTTGAAGGCTGCAACAGAGATGGAACACAAGCTGAAGGTTCGAGCTCTATAGACAG
ATCGCGGCGGAGAGTTTACGTCGAATGAGTTCAACGATTACTGCGAGAAGATTGGCATAAAGAGGTTCCT
CACGGCACCTTACACGCCGCAGAAGAATGGGGTCGTTGAAAGGCGCAATCGAACCGTCGTTGACATGGCA
AGGAGTTTACTCAAGAGCAAGAACCTGCCGGGGACTTTTTGGGGAGAAGCTGTCTCGACGGCAGTCTATC
TTCTCAACCGGGCTCCAACGAAGGCGGTGATCGGCAAGACTCCGTATGAAGCAATTTACGGACATAAGCC
GAATGTGTCTCATCTACGGACATTCGGGTGCGTGGCACATGTGAAGACGGCGGAGCCACATCTCTCAAAG
CTTGCCGATCGTAGCACCAAGATGGTGTTCATCGGATACGAGAGCACTTCTGGCACTCACGGGGTTATAG
TCCTAGGGTAGGGTCATAGGCCTGCCCTGTAGGTCCTACCCAGGGACTACCCCTCGCAGAGGACATGACC
CTTAGTCAACTCCGGCTGAATTAAGGAACCCCTGTCGTCCAGTCGGTAACATACCCTCGGTCCTCCAGTC
GGCGACTAGCATTCGGAGCATATCGAGTCAACCGACTGTGTACCACTCGGTACATCGTAACCCCCCTGGG
GGGAAACGGTCGTACGTTTCCGGGTGCATTTATTAGCATTAAGGGCGTACGTTACCTGTAACGTACACAT
TCAATCGCCACTACTCCACCCCTGTACCGGAACCGTTGTGGAGGGCAGCGCACTCTATGTAAGCCACCCT
CCCCCACTGGTAAAGGGGTTAGCAACTCATTGTATTCCCTATTCCACTCGACAACAAAGCTCCCTGAGCA
CTGAGACGTAGGGTTATTACCTCCACCGCAGAGGGGCCCGAACTCATACATCCTCGCCGTAGCTGGGACT
CTGCCCATCCTTTTCGTACCCTACACATCTACTGTCAGGCTTATACCCACGACAGGCACCAAGGCATACC
GTTTCTACGATCCACAAACCAAGCGTCTACGGATTTCACGCGACGTCGTGTTTGAAGAAAACCAAGCGTG
GAATTGGAGCGCCACCGCCGACGATGCTCCAAACAGTAACATATTTGCAGTTGAATTTCCAACTGATGAT
GATGCAGGGGAGGATGTCCACGTGGTTGGCAAGACGCCCAACCAAGGTGACCACAATGGTAGTGATCATC
ATGGTGCCGACACCGACGACGACGCGCATAGGTCGCAAGGAGATAGCGACAACGCAGCGCACGACACAGG
CGGAGATCTCGACGACAACATCGACAACGAGGCGCATAGTGACGACGACAATCAAAATGATGGTCACGGT
CACGACGACTACGCCGACGACACGGATGTCGATGACACACCAGGGTCTCAGCCGTCTTCCTCAAGTGCAT
CAACACCGACACAATTTGTGTCGCCTCCTTCGCAAGCCACAACGGACTCCTCAGGGCCTCGTCGCTACAA
GATGCTCAAGAAAGTCTACAAGTACACAAAGCCAGTTACGCTCGAGTACTCCGGACTATGTTTGTTCGGA
GTTGAGGAGCCGGCGAACTTCGTAGAGGCGAGCAAAAGCCGTAGTTGGACGCACGCCATGGATGAGGAGA
TGAAGGCGATTGAAAGCAATGGCACGTGGACTTTGGTAACCCGTCCTCTAAACCAAAAGGCGATAGGTTT
GAAGTGGGTTTACAAGTTAAAGAAGGACACAGAGGGTGCCATTGTGAAGTACAAGGCAAGACTCGTTGCA
AAGGGCTACATTCAACGTCAAGGAGTTGACTATGATGAGGTGTTTGCACCAGTTGCTCGAATCGAGACGG
TGAGAGTGCTCCTAGCTTTGGCAGCACAAGAGGATTGGAAGGTTCACCATATGGATGTTAAATCCGCTTT
CCTCAACGGCGATCTCACAGAAGAAGTGTACGTGGAACAACCCCTCGGCTACGAGAAGAAAGGCGAAGAA
GGGAAAGTTTACAAGCTCAAGAAGGCACTTTACGGGTTGAAGCAAGCGCCAAGAGCTTGGAACTCAAAGT
TAGACCGAAGTCTGGTCTCGCTCGGGTTCAAGAGATGTCCCCTCGAGCACGCAGTCTATACAAAGAACTC
CAAAGGCTCAAACCTGCTAGTTGGAGTTTATGTCGATGATCTGATTATCACCGGAGATAGCGTACAAGAA
ATTGAACGTTTCAAGGCGCAAATGAAGAACAAGTTTAGCATGAGTGATCTGGGATTACTCAGCTATTACT
TGGGCATCGAAGTGAAGCAAAGCTCCGGAGAGATTTCCCTATGTCAATCGGCTTATGCGGTCAAGTTATT
GGAAAAGTGTGGCATGTCCGATTGCTACGAGACACAAGTTCCAATGGACCAACGTCACAAGTTGAGCAAG
CGTAGCTCAAATCCGCCGGTGGACACCACAATGTATCGAAGCGTTGTGGGCAGCCTGAGATATTTGGTGC
ATACCCGACCTACTTGGCGTATTCAGACGGGATCGTGAGTCGTTTCATGGAGAATCCAACAACCGAACAC
ATGAACGCGGTCAATCAAATTCTACGCTATGTGAAAGGCACCATTAATCTTGGTTGCACGTACAAAAAGG
GAAAGGAAGGATTGATTCTTCGTGGATATTCGGATAGCGACATGGCAGGTGATGTTGATGACCGAAAGAG
CACAACGGCATGGTTTTCTACCTTGGCCCAAATCCGATTAGCTGGAATTCTCAGAAGCAAAAGGTGGTGG
CACTGTCTTCATGCGAGGCAGAATACATAGCGGCAAGCACGGCGGCTTGTCAAACAGTGTGGCTGAGAAG
ACTCCTAGCTATTCTTGCAAAGGGGAGGTGCAGAAGGTGTCATTGAAGATTGACAACCAAGCTGCAATCT
CATTATGCAAAAATCCGGTTCATCACGAAAGGAGCAAGCACATAGATACCCGGTTCCACCACATCCGGGA
GTGCATTGAAGAAGGGTTGATCGAGGTTCAACATGTGAACACGAAAGACCAACTTGCCGATATTTTCACC
AAGTCCCTCGGTCGACAGAAGTTCATCGAGATGAGGAGGAAAGTCGGAGTGAAAGAAGTGAAGTCAAGCA
ACAAGATTAAGGAGGTGAATGTAGAAGTTAATCATGTTGTTTCTTTAGGATTAGAAAACAAAGCCAAACC
GAGTCCTAGTAGTATTAGGATTCCTAGTCCTAGTCTATTTCCATAGTCCCTTGTGGACGTGTATAAAAGA
CACCCTAGGGGTGTTGATTGTAACACCAGAAAAACGAAAAGCAATACAAAGCAAAGGCTCGACACGGGCC
TTTAGCCATCAAATCCATCGATCAGTTTTATTCGTGTCGCTAGTTACGCAAGTTCCGTCAAGTAGCCGGC
CGAAGCAAGAATCGCGTAGGCACGCCTGTATAGCTGCATACGCACATTCAAAAGCCAACAGGTAACCGTG
GCTTCGACTTGGGCCTGCAGGGAACCTGCTCACCCTTCGGCGGAATGTCTCTGTTCTTATCTATTGTGGT
GGAGCGAGGGTTGGGGAGGCAAAGGAAGCGGAGGCTGCGGTGAGGTGTGCCCTGGAAGCTCATCCCAGCC
ATCCCCGTATTTATATTGACATGAGGCTGGATATACAGGAAGGTACACACACTGCATCTAACTAACTACT
TCTGCATTTACGTCTTTGCTTTTTCAATGTTCTCAATGATGGACCGATCTTATTACTTCCTGCAAGGATT
TGATTTCTGAACTCCCAAGGTGCTCATGATGACGATTTGTGTGAGAACCAGGACGAGGGCGAGAACTGAT
TTTCCACTACCTTCCTTTCTCCATCTCTGGAGCTCAGCTTGTTGTCGTATTGATCAACGCTCTTCACCAG
TGCCTATGTAAATTATAAAGATTTCAAAGTGTTTTACACAAGTTGCTTGGGCATAAGTATATATCTGAGA
AAAGAAAATTGGTAGCGTAGTCTGGAACTTGCTCATTCTCATTTGTTGGCAAGTGCTTATGAAATCTAAG
GATAACTGGTTGTTTTATGCAATTTTGTAGAAGGATACTTGATAGTGGGGACTAGGGACTGGGTCAGATG
TACATGTGTTTGGACATATGTGAATTTATTATGCAATCTTACAGGCTACAGCTCACAAGTACTCTAGGTT
ATACAATATATTTTTGTCTAGCTGACAAGCTCTCGAGTCCTAGCACTAATTTCACTTCTCTTAAATTTAG
AAGGGGCCTACAGATTATTTTTAGTCTGAGAAATAAGCAAGATTTAGTCTGAGAAATAAGCAAGCTTGCA
AAAACATCTTAAATTGTGGGACGGAGGGAGTAGCTCTCAAAGCTCACAAGTGAAACGACACCATAGATAA
TTTTGGTATGTAAAAGGTCCACTTAAAATCAAATTATTACGGTGTATAGCATTCAGAAATAGTATCAGTG
TGGTACAGAAAAATTGCCCTCTTTTACAATAGAAAAGAGTCAATGGATCATATATTTTTAAGTGTTCGGT
TGCTCGTTATATTTGGAACACCTGTGGTTTTGATACAGTTGCTGTTGGCAGAGAGAGACTTTATCATTGG
GTGATGAATTTCAGTGGTACAGATAGGAGTCTGATTACTTAGGGGTAGCGGCTTTTATTTGGTCTATTCG
GAAACCGAGGAATGATAATTGCTTGAAAAATATTTTTCTTATG

>gi|33352145|emb|AJ564259.1|PPA564259 Physcomitrella patens partial ena2 gene for Na P-type ATPase, exons 1-2, splice variant 2A
ATGGTCGACATCCGAGAGTTGATGGAGGTACCATGCGACGAATCATGCTCAAACCATAGCAAGTCCTTCG
AGGAAGTTATCAAGGTTCTAGACAGCAATTCGGAGTTGGGGCTCTCGAATGCCAAAGCTGAGCGATTGCT
GAAGCAGTACGGTCGCAACGAGCTCAAGGGTCAGGGGGCAGTGAACCCATGGAAAATTTTGCTTGCGCAA
GTGGCCAACGGCCTGACGGCCGTGCTGACAATCGCTATGGTGGTGTCTTTCGCCGTAAAAGACTACGGCG
AAGGAGGAGTGTTGGTGCTAGTGATTGCATTCAACACCATCGTTGGATTCATGCAAGAGTATCGCGCGGA
GAAAACCATGGATGCCTTGCGAAAGATGGCGTCGCCGTCGGCGAAGGTCATCCGAGAGGGTATTCAGCAA
AGAATCTCCAGTACGGATGTTGTTCCAGGAGATGTGCTGACTTTCGAGGTCGGCGACATTATTCCTGCAG
ACTGCCGACTGATGGAGGTCCTGAATCTTGAAGTTGACGAGGCTTTGCTCACTGGTGAATCTGTACCTTC
GATCAAGCTCGTAGAGCCAATTCTGGGCAAGGATGTCTCGATTGGCGATCGCATCAACATGGTGTACTCG
AGCACCACGGTGGCGAAGGGAAGAGGTCGAGCAATCGTTGCATCCACCGGGATGTCCACTGAGATTGGAA
AGATTTCCAACGCAATCAATGAAACACCTGCGCAATTGACTCTCTTGCAGCGGAGGCTTAACATGATGGC
ATACGTGCTGATGGTGATCGCGCTCATCTTAGCACTGATTGTTTTTGCTGTGAACAAATTTGATTTTAAC
ACGGAAATAATTATCTACGCCATCGCCCTCGCAATTGGTGTCATCCCAGAGGGGCTTATCGCGGTCATTA
CCATTGTGCAAGCTCTCGGCGTACGGCGGATGGCCAAGCAGCATGCACTGGTGCGGAAGCTGGTAGCTTT
AGAGTCCCTGCAGGCGGTGACAAACATCTGCTCAGACAAGACCGGCACTTTGACGCAGGGCAAGATGGTG
GTGACGAATGTTTGGTTCCCTGGACACGACTCCGAGTACATCATCTCCGGCCAGGGATACGAGACCAAAG
GCGACATTTCGGCTCAGGGCCGTGCTATCGCCACAGAGACAGCGCTCGAGGACTTGAATTTCCGGAAGCT
GGTGGAGTGCTGCGCGTTATGCAACACGGCAAACATCGTTGAGGCTTCACAGGGCAACGTGTGGGGGGAT
CCAACTGAGATTGCTCTGCAGGTGTTCGCGTACAAAATGCAGATGGGGAAGCCTATCCTGCGCAAGACCA
AGAAGCCGGTTGAGGAGTTCCCCTTCAGCTCCGACACCAAGCGGATGAGCATGGTTTACCTAACAAAACT
CGAAGACGTGCTTGAAGTTTATTCAAAGGGGGCAGAGGTTGTGCTGACAATCTGCGACGATGTGATGGAA
CGGACGGGGAACCTCAGGAACATCAGCGAGGACGGTGAGTTCATGAAGAATGTGACTGTACAACAAGAGG
AGATGGCGAAACAGGGTTTAAGGGTTTTAGTGATAGCCTACAGACAAGAATCTGAGCGAGCGATTGGCAA
GCCGGTGTGTAAATGGAAGCGTGAGGATGTTGAGAGTAATTTGACATTCCTAGGGTTGGTAGGAATCCGA
GACACTCCTCGGATAGAGTCCAAGGAATCTGTGAGTCAGTGTCACCAAGCTGGTATTACTGTCCACATGC
TCACGGGAGATCACAAAGCTACGGCTCTGTCCATCGCCAGGGAAGTTGGCATCTTGGAGCCACTGTCCGC
ATCCAAGAGATCTACATCGAAACGTGGAGTGAAAGGTGATGCCCATGTGGTGCCCATGTCATCGTCTGTG
ATGACGGCAACGGAGTTCGACCCGTTGTCGGAGAAGGAGGTGGACGCACTGGACGAACTTCCACTGGTGA
TTGCGAGGTGCACACCATCAACGAAGGTGAGAATGATCGACGCACTGCACAGGAGGAAGAAGTATGCGGC
TATGACGGGAGACGGAGTGAACGATGCGCCCAGTTTGAAGAAAGCGGACGTGGGAATAGCCATGGGAGCT
GGGAGTGATGTGGCCAAGACAAGCAGCGAAATTGTACTTACAGACAACAATTTCGCAACAATTGTTCAAG
CCGTGGCCGAGGGACGTCGAATATTTTCCAACATCAAGAAATTCGTTGTGCATTTGCTGAGCACTAATGT
TGGACAGGTCATTGTGCTCCTCGGAGGGCTGGCGTTCAAGGATGGCTCTGGAATGTCAGTGTTTCCACTA
TCCCCTGTACAGATTCTATTCCTGAATCTTATTACGGGCACGCCACCCGCCATGGCATTGGGAATTGAGC
GTGCCTCCTCCACAGTCATGCAAGTACGACCATATCTCAAGGGACTATTCACGAATGAGCTCATCGCTGA
CATCCTCGTTTACGGTACCTTCACCGGCGTCTTGGCCCTTCTGAATTGGGTGCTTGTTATCTACGCATTC
GGGAATGGCGACCTTGGCAGTCAGTGCAATACTTCATCGAATCTGGGAGCTTGCGTGACCGTCTTCCGCG
CTAGGGCGACTGTGCAAATGGCATTCACATGGATGATCCTATTTCACGCTTACAACTGCCGACACTTGCG
AGCAAGTCTGTTCACCACGGAAGGAGGCGGCCGTTCTCGCTTTTTCGCCAACAAATTGATGGTTGCCTCG
GTGTTCTTGGGCGCTGTCGTGCCAGTTCCCACCCTGTACATACCGGTCCTCAACACCGGCATCTTCAAGC
AGGAAGGTCTGACATGGGAGTGGATCCTTGTCGGTACCACCATGGTTGTGTTCTTTCTGTTGTCGGAGTT
TTACAAGTTGCTCAAGCGGCGCTTCATCACCACCCCTTACACTATGTAGACTATGAATTCATTCTGAACT
CTAACCCCAAGCTTTGGTTTATCGTGTTTACCTATTATCTTAACTGTAGAGAATACATACATATATATAT
ATATATATATACATATCTCGTGGTGCCGTACATTCAATCAATGGAATAAACAGAAATAGGCCTTAGTAGT
TGAAGTTTCTGCGTCGGTACTGACGATTGGAATCGTAATTCAATCTAGGACCAGGGTGAGGAAGTAGCCG
AACGTTGTAGAAATTTTTCTCGCCTGGTGGTCAGTTTAACGATTCCAATTTTGTTTAATGAATTGATTTC
GTACAAGTTTTTTCACTGGATTGAATAACATAATCTGATCGGTGGCAAGTTTGCTAATTTTAGATCGTCA
GTTCCGTTTTGCGGCAACTATTGATTGGGAAGATAAATTGTGGTGCAGTGGTTTACTGATACAATGCTGG
GTATCGCATGGCCTCTTCTTAGTCTTCGTCTCGATTTGGATTGAAGCTCAACATCACTCAAACACTGCTT
GGTCAAGAGTGATAACAAGAGATGAAGAGTTCCTAGTGCAGGTGAGCAGTAACTATGACATGCTGAAAAC
CATGCAAGTGAAAGTAATACTTGATTGGGCACTTAAGTGAACCAGCGTAGTTTGTCTCAATGTAAATAGG
TAACAATCTCTGAGGTGGGATATGAGACGTTAGGAAAGGAATTGATCAAGCACTTCTGTTGAATTCATGG
TCTACACTCCCACCTTTTGACCGTCGTAGAGAGATTCTTGCAGCATGGAACTTTTGGAATGTCCTGGAGC
ATCCCTGATGAAGATATTCCCTCCTCCAGTTGGCAGAGACGATCGGGGAAGATGCCGAAATGCGTGACTG
CAAGAGTGAAGCGGAGAAAGGTTCGTGATTAAAAAAGACGATCACATTTGCTTGGACACTGATGTGGTAG
AACAGGCTTAGGTCT

>gi|28141083|gb|AY182778.1| Lycopersicon esculentum type 5 protein serine/threonine phosphatase (PP5) gene, complete cds, alternatively spliced
GATCATTTATGATAAAATTTGAATCATGTACTTTTATCTGGAGTTTATATTGAAAACCTTTTTCAAATTA
GTTCATAATTTTTCAATTTGATGATTAAATTATGAGACATAATATGTTAATATTAATTATAATTTGTGAT
ATTTTGTATCTAACTTTATATCGCCAAAATATAGAAAGTAATTGTAATCTATTTATGATATGAATTACAA
TATTATAAGAATATGTATGAATTATCTATTAGAGAAAAGTATCAAATAATTAAACTGTGGAGAGATTGAG
TGGAAAAATGATACTTCCCATTAGAATATTAGAAAATAATAGTGCAAAAATTATTATTTGGACTATTTCA
AATCTTATATATATTTTTATTATCATTTAACACGTTAAATTGTGAAATTATCAAGTGTAGTACAACAATG
GATACTAATTAGTTTCTTCTAAAGATTATATATATACTATCATCACATTATTTTTTACTCATTAATATAT
GGACACTTTAAAGTATTTTCTTTGATACTAACAATTATTTGCCCATCTACTTAAAATCTTTATTTTCATC
CCTAACAATTCTTCGCCATTAGATTGTTGTATCTCAAAATATCTTTATTACTCTAGTTACTTATTTAATA
TCTCGACGTGTTATTTATTTTATTATAAAGTTTTTTATTATGAAAATTTTAAAATTTATAATAAGGTAAA
ACTTTTAAGTTATTTGTTTAATTACTACTGTTATTCTAAGAGCTTGGATATGAATATCACAAAATTTAAA
ATTTTATCGTATAAAGTAAGAATTAATATTTAAAAATTAAAATAACGTTCTAATCGTAAATAAAAATTGA
AGTTATTTTAATTTTCTTTTTATCATATTTTAAGATATAAAAATAAAAATAATCTCTTTATATTTTTTGA
ACTCTAAAATTTAACTTCGAATAAAAGTAAAATATTTCAATTAATCAATAAATAATAAAGCATTCAAAAA
CTTTTCGATATAAAATATAATTATCTCAATAATAAAATACAAAATTATTTTATTATGTATTTAATTAGAG
GTATTAGCCATGTTAAATTATTTATCTCTAAATATAATGAAATAATTTATCATTTATCATAATCTAACTT
ATTTCGAAATAATTAATAGCGAATTAACTAGTAGAAAAAATTACCATGAGGAGGAGTGTAAGGAGAGCCG
GAACTATCTAGGGCTTGAAAGCACTTTAGCAAAGTCTCAGTCTTCTTTGACAAACCCCCAAAGCGCCATA
AAAAGAGTATTCATGAAAATTCCAGTATTGTGACTTCGCACGCAACATCTACTCAGCCAGCCTCCAGTCG
CCATTGTTATGCCCGGTATGGAAGCTGAGAACTCAAACGCCTCCCGAGCTGAAGAACTCAAGCAACTCGC
AAATGAAGCATTCAAAGGTAAATTCAATATACACAAACTTGAGGTTGTATCATGTGGATTTATGAATAAT
AAGTCTGTTTATGATTTCAATGTGTTTTCAGGGCATAAGTATTCGCAAGCTATTGATCTGTACACACAAG
CGATTGAGTTGAACGGTGAGAATGCGGTGTACTATGCTAACCGTGCGTTTGCTCACACCAAATTGGAGGA
ATATGGAAGCGCAATACAGGATGGAACTAGAGCTATTGAAATTGACCCTAGATATTCAAAGGTAAGTATT
TGAATTGTGAAAGAATTGGAATGGAATTGTGGTTTCTTTGTTTCTATTGATGTGTGATTAATTGCTGAGG
TTGCAGGGTTATTATAGGAGAGGAGCTGCATATTTGGCAATGGGGAAGTTCAAAGATGCACTCAAGGATT
TTCAACAGGTTGGTATTGTTTTTTGTAGCTTCTTCACTCATTTCAGCTGCAATTTTTTTATAAGCTTTAT
CTTAGGTACAACAGAAAATGTTGATGAAAAATCATTGCTTATGTAATTAGCTAACACATTTATTAGAGAA
AATGATGACATACCGGTGACATTTCGTTGGGTTAATTAGCCACCTCATAGAAGATTCTTCTCTATGATTC
ACTTGAAAACATGTCCAAATGATACTTGAGATCTTAGCAGTAACTCGCCCATAAACAATTTAGTGGTTCA
ACAATGGAAGAGATATCAAGTAATCCTTTTGGACTGTTGTTTTCTTTTAAGAGAGGGCATCAATTTATTA
TTTTGTCTCAATACTGATTCTTGAAAGTTTTTTCTTGGATTTTTTTGACAAACTATATGGTCTTGTTTCC
CAAGTGGTTTTCTTTGGTGTCTCCTCTGCATTATAGGCTCTAAATATGCTGTTTGCATGTATCTTTTGAG
TCTGCTTTATAGTTTTCTGCAGAAGATGTCCCCTATCTTCTCTAGTCAGTGTCTGGAATAGTTTACCAAT
CTGCTAATTCTGGGATGTGTTCCTTTATTGTCTCACTCAGGTCAAGAAATTATGTCCAAACGACCCAGAT
GCTACCAAAAAATTGAAGGAATGTGAGAAAGCTGTCATGAAGCTAAAATTTGAAGAAGCTATTTCTGTCC
CAGAATCTCAGAGGCGTTCAGTAGCTGACTCTATTGATTATCGTTCTGTAGGTAAGATAGCTCCAAGCTG
ATATTTCTTCCTTATATTATGCTCACGGAAGGTACCTTGGTCATAGAGTAAATTTCTTTGCAAAGCATGG
CTTTGCACTATGTTTTCTTGTCTCATCTATGCGTATAGTTGCTGGATAAATTTCTTGCATTACATGTCAT
GGCATTTCATAAGGTGCAGGACATGGTTACTACAATGGAAAAATGCTTCTTTCCCTTTCCTTTCTTAATT
TACTGCTGCTTGTTGCCATACACGTTTGATTCGTTAATTGAGGGATGAGAATTTCTCAATATCCTTGAAA
TGTTGAATTTACTGCCATGAGATTTACTTATTTGTAGAGGTTTGCACCTCTTTTGTGAAGTTTGATGCAT
CAGTAGTTTAGGTCTCACTTCTCAGTCTGATAGGTACTGGTTAGATGGTTTTTGTTGAAAAGTTTGAGAA
TGTGCGGGGGCATCAGTTTCGCCTGGGATAGATGGTAGAAAATGTTGACTTGTCCATGTGGAACTTTTCT
TTTCTCTTCCCAACCTCTTCAAATGCTCTGAAGTAACCATAACAAGATAAAGAATAAATCCCTTTGATCT
TTTCGACATTATCGTTTGGTTGCGAAGATGATATGTTGTTTGTTTACTATGTGCAAGTAAATAAAACATT
ACAAGATGTTGTTCACGAACTACTTCCAATCACTTAGTTCAAATTTAGCCATTACTTACACTTCGTGTCC
CTTTCAGGAAACGCTGTAAACCTCTAACTCAAATTTTGGCAATTACTATAGTAGATTTTTAGTTAAATGA
CCCCCTGAATTGAACATGGGTTTGTCCTTTAGATTATTCAACAATAAACCTTCATTTGAAATAACAAGAC
AAAATAAGAATCTCTAAGCTTAGTCAACTTTCAACCTTTCATGTTAGTCCATATAATTTTCATTCTTATA
AAAGTAAATTTTAATAGTAAAATTTACCTATTTCATCCTTATAGGATCAGGCCCTGGCTCATCATATGTT
CCCACCAAAACAACTGCTGTATCAGCGGCAGCAGCACTAATGGGAGTTCTGGTGGTATATATGGGGACTA
AGGCAGCCACAATGGTGGCAGCAGCAGCTTCGGCAGCCTTATTGGTGGTCTTGATAACATTTCTTTGGGG
ACGTTGCAGTGATGGTTTCTTTACCAAGAGTCGAACACTTGAATTAGGTTTGAGCCTTTATAAGAAAAAT
GTTGAACTAGTAGACACTCAAGTTAGTGGTAGTTCGCGAAATGGACATCCATCATAATCGGAATAGTTGA
ATAAGGATTAGTTGTAACCTAGAGCAAATGCTCGTATTTTATTTACATTCCATTGCGTTGCATTTGATTG
AAAATTGTTCCTGTTCAATTGATATGTCCTATGTATGAAATTACTAGGAGCATGGTGTTCCAACTAAAGC
CATTTTCGACCCTCTATATAGTATATTCAGCATTCTTAGTAGTTATTTGCTTCTTTTGGCCTTCTCTGAG
GACCATATGAGTATGGTGTGAACTCTTCAGAAAATAGATCTCTAAAATCAGTCACAGGTTTAAGTGTTTT
GCCTAGAGTACCACGTCATCCTTTGCTTTCTAACCATTAAAGTTTCTAATAAGTTAGTACTTATATTACT
CAGAGCGACTTATAGATTCTTGCCCCATTATTTACGTGATACATCTCAATTCTTGGCACATCTGCTATTG
TATTTTATGGGGAAGATTCTCTTTGGTAAGTAAGACAGTAGCGTTTTGCTCTGTGGGTCTCCTTTTAAAC
TTCAGGCTTAGAGTTCTTAGCTGCCCCTTGCTGAAGACATTCATCCCTTGCCTTATGCTTTTCGGGGTTG
TTTGGTTTAGAGACAAAATTTTCAGGGGTTAGTAATGTAAGGATTAAGTAACAAAGAGATTAATAATCCA
AGAATTTTTTCTTCTTGTATGTTTAGTTTGATATTTTTCCAAATAGTGTAAAATGTATATCATGAAATAT
GTTTTTACTTCTTAAAACCAAAAAAAAAAAATAGCTTATTTGTTATTATGATGTCGTTTTAATGTTTTTA
GTCCATGGATTACTAATCCCCACATTCTTATTCCACATCATATCTGGTATAAAATAATTCATAGATTCCC
GCATAACTTGTGTCTTATGCAAATATTATTTATGAGAAAAACATAAGTAGCAAAAAAGTTTATGCCAAAA
ACATAAGTAGCAACCAAGCATTGTCTAAATTAATGCTGGATTTTATGCAAAGGTTAAATTTCTTGACAGT
AATTAGGGATTCAATCAGTTTCAAAAAAATTAGGGATTCAATCAGGATCTTATTCTGTAATTATACACTT
ACCAAAATCATTTACGTTGTAATTGCTATAAATTCCCATTTCAAACTATCCCTTGCTGTGTTAGCTTTAT
GTATGCACTATGCAGTAATTGCTAGTTTGCTGGTTCTATTTTGCCTTTCTTACCTTTAAATTTGGAGACT
CTTTTAGGATGATTGGGCATGTGGCTGTCTGCATGTCTTGATCCTTGTCATTCTGACTCTTCCTTGCTTT
TATGTGTCAGTACTGTTTTACATATCATATTGAGAAATCTGAGAGTTTGCGTGACATTTTTTTTGTACCC
CATGATTTGTGTCTCTAACATAGTAAGACCACCTCTTGGTGTCAAGACTGTGCTGGGGAACTTGCATTCA
GTGGTTTAATCTTTATTAATACTCTCTACTTCATCTAATCCAGTTAATGAGAAATCTGCTCGCTTTGTTT
CACCTGAATTTACATGCCAGTTTGGTTCTTTAAATTGTAGAGGTGGAGCCTCAATATGCTGGTGCAAGAA
TAGAGGGAGATGTTGTAACATTAGATTTTGTGAAGAAGATGCTGGATGACTTCAAAAACCAGAAGAACTT
GCATAAGAGGTATGTTTCGTTTGAATGGTGTAATCTTCTCTTTATTTTTGAAACACTCTTAATCTTTCAA
CATTTGCTCTATTTTGACAGGTATGCCTACCAAATAGTACTGCAAACAAGAGAAATGTTGCGAGCACTGC
CCTCCCTTGTTGACATTGTTGTTCCCGAAGGGAAGCACTTCACTGTATGTGGTGATGTACATGGTCAGGT
AATGATATCCTGATGACGGATGCCTTTTTATAGCTTGTAGCTGTTATTTTTATCATTTGCTTGTCCTTTT
TTTTCTCCTCCAGTTTCATTTCACCCCTCTAGAACAAGATTTTACGTCAGCATATGGTATTGACTAAGGC
ATGCATTTATAGAAGGCGTAGAACTATCTGGTGCTTGCTAGTGATGCTCCTACATGCAAGAATAACTAAA
ACAAAAAATTCTTGTTTCTTTAAAAAATTGCTGCTTGGTTCACTGATCTATTTGGAGAAACATAAAGGTT
GATTCCTTTTGTCAGAAAAAAAGAGGGATGTTAGTGGCTTTTAGACGTCTTTAACCTGTAAGCAATTTGA
AGGCGCTGGAACCTTTTTAAAGATCGTGGGCATGTTCCCTTTGTCGTATTTCTCCTTTTCGCCCCTCCCT
AATTAAAGAATATGGTTCCTTTTGAGCTGAAATATTACTGCTATGCCATTTAGTTCGTAAGGCCTATCAT
ACATATCTGAACCGCAGGCCCTTCCTCTTGTACTTCTCTTCCCACTTGTGAAACATCTCAGTCCCCTTCT
TCACTGGAATCTGAGTTTGGATTTGTCTGATGATGCACTCGCCCACCATAAGCCTTTTCTCCCTACTTTA
GGAAGCATTTTCACCTTCCCTTTAACCAGACTAGGACCTTCATATTTGGAATGCACTTTTTTTCCATTCA
AGAGGAATGGTATAAAATAAAAGCTCTTGAACTTTATTGCGTTAGGAGCTGTGAAGGTCTGAAGGAGTCT
GTATTTAGACTCTAAGTATCATGAACCTCCTATCCAGCTTCAATCTTGTGTCTTCTTCAACTTCGATTAA
CACTGGCCTGTTTCCAGAAATCCTCAGAAGCTCTGGCTCAGAACTGAACTGGCAAGGCAACCAGTCTAAT
CCAGACTGTATCCAACACCAACCCTGAGTGTCTGCCCGACCAGTGAGTTACTCCATACTTTTGAAACACC
ATCTTTGCTTGGTCTGATGGCCCGCGCCTCCTTCTGAGAGGAATTTAAGAAACCCCTCTACCTTTGAACG
GTTGACAACCATGTGGATTAACCCACTTCTAGACCAATTTGATCTTCGGTTGTTTTAGGCTCTTCCCCAA
TCAATGTACCAAAAACCTCTATATAAAGTGTTAGCTTTTTCTCACGATACGCCCTCAACCTCCATTCTGC
TATCCCTTGCTTTCTTTATCGGAGTTGCCAGCGGTTGTTAATATGACCAATTTGAGCAGAGTTTTGGATA
ACCCCTTTTACATGTACCCAAGTTTTATGAATGGAATTTTGACTGCTTCTGTCATTGTCAAGCTAACTGG
AGAACTCTTGACCAGAAAAATACGAAAGGGTAAGATTTAGTAAAGTAATTGTTTTTTCTGGTTTAATTAA
GGAGCAAATCCTAAAGAACACTTGTTTGACTTTAGATATGTGCTGCAAGATATATCATTTAGTCCTTTAT
TCTCTCTTTCCTGCTGTTTATATATAGTGATAATACAATTTGCTGGTTCTATTTCTGTGCTTGGCGGAAT
GACTTGCTTCTTTTTGCCAGCTATAAGTCTCTACTGGCTGAACTGTTGTTCATCTTCTAATGTTGCTACA
GTTTTATGACCTCCTAAATATTTTCGAGCTCAATGGGCTTCCATCAGAAGACAATCCGTATCTGTTCAAT
GGTGATTTTGTTGATAGAGGGTCTTTCTCTCTAGAGGTCATATTGACATTATTTGCCTTCAAGTGCATGT
GTCCATCAGGTAGATCGCCTGCTCTTTTCATCTTCAATGTTGCAAGTGTGTTCTTTTATATTATTACTCC
TACCTAGTATTCTTTGGGTGGAACTTGAAGGTTTTCTGGATGCAAGTTTTCCAGTACCCTATTTTTTACC
TTAGTTATCTGTTTGTGTTAGTATTTATTTGCCTTTACTCATTCTAGTTCTATCTCTTTTATTAATTCAT
GCATCAATTATACCTAACAAGTAAGTGAATGTCCTAGTATTGGTTGGGTGGAACTTGAAGGTTTTCTGGA
TGCAAGTCCAGTCCCCTATTTTTTACCTTAGTGATCTGTTTGAGTTAGTATTCATTTGCCTTTACTCATT
TTCTGTTACTATCTCTTTATTTTTAAATTTGTAATTCAATTATACCTAACAAGTTAGTGAATGTCCGTTT
TGGATCCCTTTTAGATGTAAGCTGTTTGATCATTGCTCATTTTCCTTTACTCATTTTCTTTTTCTCTCTC
TTCTTTGTTTGTACATCAATTAGACCTAACAAGAAAATGAATGTCCCTTTTTGGTCACTTTTCGATGTAA
GCTGTTTGAGTCATTTTTCTTTTTCCATTTCCTATTTCTATTCTTTTTTATTTGTACATCAATTAGACCT
AACAGTGAATGTTCCTTTTGGGTCCCATTTAGATCTAAGTGGTGTGTTAATGCTTTTATTTGAGATTCTG
ATATTGCAATATATCAATCTCTAATCAAAGCTAAGATTTTGATTCCTTCTATACTAGCACGACCTAAAAA
GTAGCGTGTTTTATTTTTCTTCCAATTATTCAGTCGGTGTGTAGATGTTGTTCAGATGGGTCAATTGTAT
CTTGCTAACAACTTTAGTTTTTCAGCTATACACCTGGCGAGAGGAAATCACGAAAGCAAGAGCATGAACA
AAATATATGGGTTTGAGGGCGAGGTCAGATCCAAGTTAAGTGAAATATTTGTGGAACTCTTTGCAGAAGT
GTTCTGTTGCTTACCTTTGGCCCATGTCATAAATGAGAAAGTCTTTGTAGTACATGGAGGTCTTTTTAGT
GTTGATGGCGTGAAGCTCTCTGATATTAGAGCAATTGATCGGTTTTGTGAGCCCCCAGAAGAGGGTAAGT
TCTGATGCAAGTAGAGAATTGTACATGTATGATGTCCTTTCAATATGCTATATCTATACTAATTATTCTG
CTTTAAGCTTCTTAATGCTCCATTAATCGTCTGATAAACTCTTCAAACAAAGCTCGGAAAAACTATTCAT
GCAAGTTTGTGTATCAGAACTACCATTCTCATTTGCTCGGTAGTTATCATCATTACACATTATTTCTGCA
AGCCACTTTCTTGATACATGCTAATAAATACTTTTGAGTCCAGACACGACTATTATTTTGAAATAAAGGC
AACTATTCTGGTCTTTATCGATGCTTTTGTTGGCCAAACAAATTGAAACTTTCTGCATTTCTGCTTGATC
TCAGTTAGTATTAATGTATTGACTTACTTCTTTGATAAGTCATCATCAGTTTTCTGACTTATTAAATATA
TGTTGCTTATTTCTTTTTTACCTTGGTCGTACATAATAAACATCACCAAGTTGTTTAGGACCTTAGGTTT
CATTTGATCTCTTTCAGGGTTAATGTGTGAATTGTTGTGGAGTGATCCACAACCTCAGCCTGGTAGAGGA
CCTAGTAAACGAGGTGTTGGTCTTTCTTTCGGGGGAGACGTAACTAAAAGATTCTTGCAGGAAAATAATC
TAGGTACTAATCTTTTTCTTTCTCCCTTATTCTGTTGTTTGACCATGTAGAGAATTGACATTTCACTGTC
TATTTTTATTCACTTAATGGATTTTAGCACAAATATTTGATGTTGACATGTGTGGGTGCTTGCAGATTTA
GTGGTGCGATCTCATGAAGTGAAGGATGAAGGTTATGAGATTGAGCATGACGGCAAACTCATAACGGTGT
TTTCCGCTCCCAATTATTGTGACCAGGTAATTTGTCTCTATGTATTCCCCTCTCAAGAGTTTATTTGAGC
TCATCCTACTTTAGTTCAATTAAAATCTCAATTTGCAAGTCAAAAGAACACCTTTGCCTCAAAAGTCCCT
CTAGGTTGAAATGTAGCTCTTCATCAAAATCACTGCAGAGTTTTCGGTGTGTATAGATCTTGTATATCTG
TGATTTGTCGGCACTGTTGTTAAAGGCGTGCTGAAGCGAGGCTCAATACTTGTTGAGCGATTCGCCTCGC
CTCGCCTCAATGTCGTCATCAAGGTTCTACGACATGCTTTTCCTTGCGAATGAGCCTCTTCCGAAGAGGC
GAGACAGTTGGCATTTCACTTTATCGTAATCTTTTTGTTCATATATTTGTCATTCATGCTATAACTATTA
GTCTTGGACTATATATATATATATATATATTGTTTCTCCCTTTGTGCTTTTTCTTCATTAAAGTTTATGC
TTTATTTGAGCTTGAAGTCCCAACGGATCTTAGAGGTTTTTTGCTTTTAATGACACTGTTTATCGGTCAA
GTTTAGTATTGACACAACTTGTAGTCCGTTGCTTCATTTAGTATTTTAAAATGATGGGAAATAATGACTT
TCTGCTTCAAGGTAGATTTGGAATTTGTTAGATGTTGACTTTGTCAGTAACTTCGATAGATGGTGTTGTG
GACATATTTGCACAGATGGCGTGGTGTCCAGTTTCATTGCAAGTCTTGTTTCTTAGCATCTAATATATTT
TCAAGTACATAAACTGATTGCAATATGTACAGATATAGTCATAATATTTGCTACTTTTTTGTGACAATTT
ACGTGGACAAGTCAGTTTTATAGTAACTGGAACTGTGTTATCTATACATTTGTATTCCTGTAGTAGAGAA
GGATCTTGTAATAATTTCTTTGTATGACTAATACACTGTTATATCCTATATGAAGTTTCTTTGATGTGAA
TGGAAATGTTTTATTCAATATCCTCAAATGCACTTCGCTGGTTGCAGATGGGTAACAAGGGTGCTTTTAT
ACGATTTGAGGCTCCCGATATGAAGCCAAATATTGTGACATTTTCAGCAGTGGTTAGTGACTTTTATCTT
GAAATGACCTTTTACTCCTTGATAATTAACACTTTTATTCTCATCTCCTTTAATGGGTTGCCTCATGAGT
TGTTTTTACCATGTTATCATCATAACACTGTAGATTAACTCTTGTCATCTTCATTGCGTTGCCTCGTATG
CAGCCACATCCTGATGTCAAACCAATGGCATATGCCAACAACTTCCTTCGCATGTTTTCTTAAAAACTCT
GGAACCTAACGTTCAGTATTACAATCGATGCGACCTTTTGTCTGACTGACCAAGAGCATACACATCAGGA
GGCAAAAGAGCTAGTACTTACAGCCAATTAGCTGCAGTGTCATTATTCGGACAACTTCCTGACTTGCCCG
CAGCATGTGAGGATCCTCACCTCCTTTGTTTTGATTAAGGCGTAAACACTTTCTCTACGATAACAATGTC
GTGTGGTGGATTGTCCTCTGTATTATTTATATTCCTCTTTGTAAGATTGTTACACTTCTCATTTCTTTTA
GAATGTTCAAATTGGGAAAAGCTTTGATAAGTCGAATTTTGGTTTTTTCTATTTTCTTAGTTAAAATAGT
CTATAATTTTTTCCCCACCCAATCAGCCAAGTGTTACTGTTACGATGTCTATTTTACCATTGGATTGTCG
TTTGTCTGTGCCTGTGGCCAGATTACTGGTGTTTCCTACTGATTTTGTTTCGTTATTAATAATGCTTAAC
AGCTTCTAATGAGTCGATGCAAATCCTATCAATTTGTAAAGTTTGTACCATTTAAACGTAAAACTTATGG
GTCATTCCGTAGGATTTACAAAAATAGTGTTAAAAGTTATAATTAGTTATGTTTATATTTCTTACGAAGT
GATTTATATAATATATATATATATGTGTGTGGGGAAAAGTTTTGAGCAGCTACTTTGTCTTTAATCATGC
TAATGCGTACATTAAAATTTTTGCTTTACTAATAACATGAATTC

>gi|37538061|gb|AY341862.1| Hordeum vulgare subsp. vulgare CTD-phosphatase-like protein (Cpl1) gene, complete cds; alternatively spliced
TCCTCTCCCCTCTTGTGATTCCGGTGCGTCTTCCCCTCCTCTCTGCCTGCCTGCGCGCACCGGTCTCCCC
CCCCCCCCCCTCCTCTCTTCCTCCGTCCGCCTCCGCCTCCGGGAGAGGCCGAGAGAGAGGGAGAGAGGGA
GGACGCGCCGGAGCTACCCGCGCCAGCATCGCCTCGGTAAGCTCCGCGGAATTCCTCTCCTGGATTCGCC
CCGGCGCGGTTAGGGATGGATGTTTAGCGGCTGGCAGTAGCTCTGCTCGATTCGGTAGGAATTCGTCTTC
GTATAGCGTGCTGGGGGCTCGTCTCGAGTTTTCGGCTCGCGGACGCCGCGGGGGTTGATTCCCGCGCCCT
CTCCTGGCCGGGGGGTTTGGGTTTTGGTCGATTTTTCGGGAAGTAAGTTGGGGAATTTGAAGCGCCCGGT
CCTAAATCCGACTAGAAACACGCGAGATTTTGATTCTTCCGCACTCGCTAGAGTACGATAGTTGGCGATG
CTTGTCTGGAAACCCTTCCACCTTCCTTCTGGTTGGGGATTTCTATTTTTTCTTCCGTCGGGTTGGACTC
TGCTGCTTTGCTTTCGCTACCTTGGCACTAGTTCTTTCTGCCGGAATCGCACCCAGCTTGCAATTTCTAG
CTAAATCTCTAATTCCACTCGACAGTTTGTCGGGTTCTAATGCACGGCGGCGATCTGAGTGTTTTCAAGT
CACTACTTGTAGGGTTTGCTTGTTGTAATTTCAGTTTTTTCAGCTGTTCTTTGGTTACCCCCTTCAATTG
GAGTAGTGGGAACATCCCTCCAGTCAAAGAAATAATTTTATGGAAATATTTCCCTCCGTCTAAATTTACT
TGTTCTTCTCCTTTTGGGTTTGGGTTCTCGTTTTAGTTTACGCCWTCTTACCTTGTTGTTGCTTAACYTA
GATGTTTTGCTGCCTTTGTAGATCCGTGTTGTACTCCTTGACCGACTATGGCTTTTATCAATTCAAAGTC
AGATTCATTCCAAGCCTTCCGTCTAAAACATAACTTAGGTATTGGATGCCCTTTGTTATTTTGCTAGAGC
CTTTTTCCGTCGACCTAGCTCCAAAAGTAATTCTTTTGCTGTAGTATATGTTGGCAACACAGATGATTTT
GTCCTGAAATCTCTTATTCTCATGCATCCTTTTTTCTTACCTTTGATGCTTCTCAACATTAGTAATTAAT
ACTAGAACACAAGTACGTTACACTTCTAGGTTTATGTGTTTGCTTGTGCAAACTGTGTGAGACGGCAACT
CAGAGGCAGGACTTTTGGGGTTCTGGTTATGTTATCAATCCTGTCCACAATTGGCACAAGCAATGTTGCA
CAATGCTGAAGGTTTTATGGTGTGGGAAAAATTGCAATGTGCATTAGCCTTTTGGTATTCTCGTATTGTT
TGTACTGAAGATTGTGACAAAAATTGGAAGCACAGGATGCTTTTTATGTTAAATCTGTTTGTTGCGCACA
TATTGTTGGCAATGCTCTATTTGTATGTACTAGGAGGGTAAGTAAAGGGAGAWTTGGAGTGGTACACCAA
TATTAGCTCACCAGAGGACACTGTGCCATGTCTGTGCTGCTTGGGTCACTAACATGCTGTCAGATGAGTA
CTATTGCTGCACATGCATTACTTGAATACTTCCAAGTAACATCAGACCTACGCGCCATCTTAGTATAGTC
ACTGATGAGGTCTGTTTGCTTTAGGTGTGTATATGTCACAGAAGCTCGATGACTCTTTTTTCTTACTTTA
TTCTGCAAAATACCATGGGTTTAGGTTTTTGTTTAATATCAGTACACATTATACACCTTCGTAGTCCATG
CTGAATAAGGAAGGCAGAAGTGTTCTTTCCCCTTTTTCCCAAGTAACCCGACAGGGTAGGTAAAAATGTT
GGCACCGGCATGTATTCATTAAACTATTATGGTTTTGTTTCCTTGTATATCTCTGAATGTTGGGCCTCAG
TGTTTTCTTCCTTCTTTAAAGTCGTATTTTGTAACTTCTGTAATGGATGTGCAGACAGTTTTGGCAGTCT
GAACTGCTGATCAAGATGCCAGCACTGAGAATGAAGAGGAAGTTTGATGATGACATTTTCGGGAGTGAGT
TTGACATCAAATCCATGAAATCGGTGAAAATCTCGCCTTCCCAAGTTGATGAGTTCGAGCAGGCATTTGT
GTTAAACTCGTCTTACAAGGACCCTCAGGATGGTAAGTGACTGCATGGTTGCTCTTTCAAGAGAAGAGGT
GACTGCATGTGCATGGAATATAGGTGTCTTGTTCTCTTATGACTAAAATATATTGAACGTAGATATTTCC
CTATGTTTCAAATAAGAAACCTTCCAAGTTAGCTCCAATGTCCTTATTGGTTCTCTATGCTGGTGATAAA
TGTGTACCCTTGACTGGAATTTTGACAATTATGTACGAGTATGTCTTTAGCAGTATATTCAGTAGATACT
CATGTAGTCATGTTTCTAAATATTTGGCACTGTATGACCAAATCACACATGTCATGACGTGCCTTCAGTA
AAGTTGAACCATAAAACGCTCTACCAGTATTATAAGCACGACTGTGAATGAATTCTAACATGGGGCAAAG
TTAATAGGTGTATTTGGGGGAAATTTGCCTTGAGATTAGCAGATTGACAAGTGTTGGGGAAAGATATTCG
TTCAATCTTTAAGAAACGGAGGGAGTATTATCTGTAAACTCACAGTAGATAACTAGATTAGTTGGTTGTG
TCTTATTGATTTGTTCACTTTTACATGTAATATTTGTAAACAAAGTAGAGCAATACACTGTGCATGGTTG
ATAATTCAAGGTTAGTGAACCTGTGTATATTTCATATGGATTGATGGTCTCTTTACTTTTTTTCAGAGCC
TGAGCCGATAACTCAACTAGCYGTCCAGGATATTAGGGTTACAGAATTTTCCGGTTTGCATGCTGTACTT
GGAGGAACATCCGTTGCTCTGCTGAAGGTATTGCAACATCATCTGACTCAAATTTGACTCAGTGATAAAA
TATTGTGCACTTATCCTTGTGTTTAATCATTTTTATTTCAATACAAATATCTAGTGTCCTCTTGTATTTC
AACTGCCAAATTATCACATTGCTTCCGTTGTTTGTAATATTACCACTTAGACTACTGTTCGGTACCTGTC
CAAGTTAAATGTTCTTTTGATGTTAGCTTGCCTTACATGTCAATGGATGTTAAATTTCTTTTTGGTTTTC
TTGTTAATATGTTCAGATGATTGCTTTCAACTACTGTTCGGTACCTGGTCAAGTTAAATGTTCTTTTGAT
GTTAGCCTGCCTTGCATCCCAATTGATGGTTTGCCTGACAACAGTAAATGGATGTTAAGTTTCTTTTTGG
TTTTCTTGTTAATATGCTCAGATGATTTCTTTCAGCAAGTTATCATTGTTGATTTCCAAATTCGATGACA
AATGAAAAAGGGTGCAATTTCGAACTAGAACTTTTGATGATGGAATTTACCTGTTGCCTATTGTCATTTC
ACCTTCCACTTAAACTTGTTCAGATTAAATGATTAAATTCTTAAATGCCTCAAATATCTTGTGAAGGCTG
TAGAATGTTGCCATTGTTTGATATTTGCTATTATGATCTGAACTTCGATGTAGCATGTTAAGGTTGGTAG
TACTTTGCTTTGTTACTTTTTTTGGTCATATCTCATGCTTAATTTCTTTCTGAAGTCCCAACACTATATA
TCAGCATCACCATTGTCAGTTTCATTGGAAGAACCTCTGCAACCTAACATTATCATATTGATATATGCAG
GATTTAATATCTGAAACTGTGGTTCCACCAAATTTGGAACCTGATTCTTTATCTAATAATGATGATGGCA
AATCTCAGTCAAATGTAGTGAACACCGGTGATAAAGGTAAGGAGTACCCCTTACCCCTCGAGCAGTTTTT
GTAACTAATGTGGCTAGTTTAGGTGATAAGTTTTTGTTCACGGCCAATGTCTATTTGTCTGCACGTATAA
AAATACACAGCCGCCAAATGCCATGTTTTAGAGAACACATTTGATATGCTCACAAGCAAGGTTTAACCTT
TGCATGTGTATATTCACTTACAATTTGCATTGCAGAGTTTGCAGATGAAGATGTAAATTCTGCAGCACAA
GATATCTGTACTGTCAATGATCATGAGAAAAGCCTGGGCTCAAACCCGGATTGCAGCCTGTTGGATATTT
ATAATCCTGATGATGCTTTTCCTTTCTTATTTGATGTTCCAACTGGTCTCCTGGCTAGCTACAGTACATT
TTGTGATGAATTTGTACCCATCGATTCATTGACAGACATGAGTGGCATATGCGGAGTATTTCCACTTAAT
GAGAGCACCGTGGAAGGTTGCATTGGCAATGAACCATGCCCATCACAAGGGGATATGTGCTTTAATAACT
TTGGTGGGGAGTGCTTTAGCCATTCTGAGGTTTTAGAGTGGTTTAATCCATATATGGATGAGTCTGATGT
ACCTAATCTTATTGGTTATACCGAGTTGAGCTCAGATGCTGCTTGTGTATCTAAAGAGCAAGGGGCCAGG
AAGGTCACTCTTGTGCTTGATTTGGATGGTATGTTGATAGCATGAAAATACTTGCTTTCTTTGGTAACTT
ATTGCTAGCCATTGAGAATAATGTATTGATTCTTCCTGTGCAGAAACCCTTGTTCATTCAACTCTGGAGC
ACTGTGATGATGCAGATTTTTCTTTTCCAGTGTCCTTTGGTCTGAAAGAACATGTGGTATATGTGAGGAA
GAGACCACATTTGCATATGTTCCTCCAGAAGATGGCTGAGATGTTTGACGTTGTTATATTCACAGCCAGC
CAAAGTGTTTATGCAGACCAGCTGCTTGACAGGCTTGATCCAGAGAACACATTGTTCTCGAAGCGTTTTT
TCCGCGAGTCATGTGTATTTACGGAAAGTGGCTACACAAAAGATCTGACTGTTATTGGAGTTGACCTTGC
AAAGGTTGCCATAATTGACAACACTCCGCAGGTAAATTCCTACTATTAAATTTTCAGCACTTCTCTCACT
CGTACTGCCACAGTTGGATTAAAGCTTGCAAAGTGTCCTTAACAAACATTTCTGTTTGGAAGTTTGTCCT
TGATTACCATTACATTTTCTCTTCAAAGCTTTGGCTATTCGTTTCTTATGATACTTATTATGCGTGCTGT
ATACAGGTTTTCCAGTTGCAAGTGAATAATGGTATACCCATAGAGAGCTGGTATAATGACCCCTTTGATG
AGGGATTATCTCAGCTGATTCCATTCCTGGAGACACTTGCTGTTGCTGATGACGTCCGACCCATAATTGC
CAAGAGGTTTGGCAACTAAAAGGATAATGGCTGAGGTTTTCCAGCAGGTGTTAGGAAGAGTTTGTTGGTT
ACTCACATAGAGGGACAAGAACTTACATGACACATTGACCGAGCTAGTTGAGACTTGCCTTTTTCTTAAT
TTTATTTACATGGGTTTCATAGGATCAAGAATTTTGGTGGCAGAGCTATTTCTCGTGAATTGTAAATATC
CTCAAACACTGTTATAGAATTTTGTACATAAAAACTGTTAGAAATGAAAGCGAAACTCTCT

>gi|34481848|emb|AJ507395.1|HVU507395 Hordeum vulgare subsp. vulgare rpoT gene for DNA-directed RNA polymerase, chloroplast precursor, exons 1-19
CAGTCGCGAGGTTGACACAAACTCTCACCGTCAGATACCAGCCCGACGCGATCCAACGGCCACGCGCGCG
CCCTCCCCCCTCCAAACCCCCGATATTTTTTCCCCAAGCCCCCTTATCACCTCCCCCTTCGGTCTCCTCC
CTCCCTCGAAGGTTCTACCGAGGTTTCTCCTCCGCCACCTCCTCCACCCCACCGGCTCCCAATTCCGGCC
GCCGGAGCGCAGCCCCTCGCCGCAGGCGGCGCGCGTATGCCTCTCCTGCTCGCCCCCATCTCCACGTGCG
CGCCCCCGCCGCGCCCCCGCCTGCGCCGCCTCTCGCCGCCGCCGCCCATGGTGGCCGTCGCGCCCGCGCC
CCCGCCCCGCCCCGTCACGCTCCTCCCCATCCTCCCCGCGCCCCCGCCCCTCAACACCGACGCCTTCGAC
TGGCTCGACCTCTTCGCCTTCCTCAACTCCCCCGCCGACTCCTACCAGATCCCCCACCCGCCCCCCTCCC
CCGCCCCGCCGCCGACGGCCGAGGAGGAGCTGGCGGCGCTCCTCGAGAGGGGGAAGGAGCGGGAGCGGGC
GCGGCGGGCGGGCCACCGGCGGCTGCGCCAGCGCCAGGTCAAGGCGGAGACGGAGGCCTGGGCGCGCGCC
GCCGAGGAGTACCGCCAGCTCGAGCGCGAGATGCTCGACCGCAACCTCGCCCCGCAGCTGCCCTACGTCA
AGTCGCTCTTCCTCGGCTGGTTCGAGCCGCTGCGCGACGCCGTCGCCAGGGACCAGGACGTGCAGCGCCG
CAAGCGGGTCAAGCACGTCTACGCCAAGTACCTGCTCCTGCTCCCGCCCGAGAAGGTCGCCGTCATCGTC
ATGCACAAGATGATGGGCCTCCTCATGTCCAGCAAGGACGGCTGCGGCAGCGTCCGCGTCGTCCAGGCCG
CGCACTCCATCGGCGAGGCCGTCGAGCGCGAGGTTTGTTATTCATGGCCCGCTTCTAAGCGCGCTTTCAT
GGCAGACAATATTTTTCCGATATACTATACTGTATCTATTTGTATGACTTAGAAATAGCTCGTTTACCAC
AATGTGAGATTTAGACTTAGTGGTGGGTGACATTAGTGTAATTAATGTAGATAGATGGACTGTAGGCGCT
GTTGTGCAGGGCTTTCACTTCCTTGTGCTTTCCATCTGACTGGCAAACAATTTGACTTGATCGAAAGTGC
CCAATGAGAAATTTGGCAATGTAATGAAGTTAACAAATTGGAGGAACTGAGGACATTATGGAACTGGTTA
GAATATTTTTATCTCCAAATTGTGTCGTGGTGGGATAGCTGGATGAAGTTGTTGACCTACTTTGTTTATT
AAGATCCAATAGATACATCTTGTGAGCTGGTCACCAAGCGGCGATGGCATCTATGTTGCCTGTTTCACAA
TAGGTTTTCTGGCACTGACCATGTGACATGATGTCAGATTGCCAGATCGGAAATCATGTGCGCTAGATTT
GTATTATATTTATGGATGACAAAGCCTTTGATTAGGGATTCATCTTCCTCTGGCTCAGGCCTCGGCTGTT
CTTCTTGTGCGCTAGAGGTGTATATGTTGTAAATGACTGGAGTTTGATCACGTTCATTAGGATGAACTTG
ATGCTATTATAGGTTCTTCACTTTGCCATTTCAGTTGTCACCACACAGTGTTCCCTTAGTGGCAATTGAT
TTTTCTGTGTTTTGAAAGCTATCTATTGTTCTGCAGTACAAAGTCCAGGCTTTCTTTCAGAAGACTAGGA
GAAAAACTAGGAGCAAAAATGAAAGTGAAAATGATCCAGCATTAGACAAGGAGCAGGCAAAATGCCGGAA
ACTTGTTAAGAGCTTGGTGAGGAGACGAAAATTGACTGAAGCACAGAAGCTTGTGCAACAAGAGATTGAA
TTGGAGGAATGGGGTGCAGAAGCCCAAGTGAAGGTTTGTTTCCGGATAGCATACCTACAAGTATAGAATT
TTCTCTAATGTGTTATGAAAGATGATCCTCCTTTTGTGACTGCAGCTAGGAACTCGCCTGATTGAATTGT
TATTGGATTCAGCATTTGTGCAGTCACCAGCCAACCAAACACCAGACAATTCTCCTGATTTTCGACCGGC
ATTTAAGCATGTATTGCGAAAGCCTATTGTAGAAAATGGGTAGGGCTGCACATTTTCCCAGTGTTTGCCT
TTGTTGCATGCTTTGTGTTCGCACTGACATGTACTGTTGTGTCAGTATCATCTGCTTGCTTAGATTGGGT
AGATCTATTCTGACATTTCTCCTCAATGAGCAGGAGACTAAAGAAGAAGCACTTCGTGATAGAGTGTGAT
CCTCTTGTGCATGAGGGGTTTGAAAGCACTGTAAGCTTGTGTTGCACCGCTATGCTGTTCTTTTCTGGAT
GAATATATACGTTTGACCTTTAAAAAATGGTCATCCAGTTGTTTTCCTCCCTTATAATCTGGATTTTCTC
AAGTGTCAACCCATCGAGTTTGTTGAAACATTTACTTGCAGTGCTCGATGCATTGCAGATTCCATTTTCT
TGTTTTTTATTTGTTCAATGGAAATGCTTCACACACATTTAGAAGTTTGAATTTCTTGCAGGCCAGACAC
GTGGAAATACCCTATCTCCCTATGCTGGTACCTCCTACAAAATGGAAGGGGTATGCTAGTGATTCGTGCA
GTTGTTCTTTTTCAGTTAATTATGTTGGGTATTTGCTATCTTATCAATATTTGAAGTAGCGATTTGCAGT
TAATTAGATGATATAATTGATCGCATCTTCTGTCCGATGATCATTTGCCAACCATGTATTGTTTCAGCTA
TGATAAAGGTGGACACCTTTTTCTTCCTTCATATGTTATGCGGACACACGGTGTGAAGGATCAGAAGGAA
GCCATTAAGAGTGTTCCAAGAAAACAGCTGCGAAAAGTATTCGAGGTTTGCTGACCACCCATCTTTGATG
CAGCCTGCATTTATATTCTTATAAACTTGTTTCCCTTGGCACAGCGGCACATCATCAACACTTCGTATAA
GTTCTCTATTGCTGTAGTGAGTTTTAGTTTCATAACAGCATGTTCTAGATATTCTTCCTGCTTTAATGAT
TATTTCTGATGTTTATTCATTTGTGCTTGCTTAATTTTTATTGAATGAAAGCAGTCTTAAGCATTGTCAT
ATTGCAGGCATTAGATATCCTTGGGGGTACTAAATGGAGAGTGAATAGAAGAGTACATGACGTTGTTGAG
ACTATTTGGAGTCGTGGTGGGGGGATTGCAGGACTTGTTGATAAGGAAAATGTGAGTCAACTGCATATGG
TCAATTATGACATTGTAAATACTTTGTTTCTTTCCATTTTTCATAGAACGCTCTAGTGGCCACACATGTT
TTTCACTACATGTTTGCGCTTTGTTTTGTGTATAGATTCCTCTACCTGAACGACCTGAAACAGAGGACCC
AGATGAAATCCAGAAATGGAGGTGGAGCGTAAAGAAGACAAAGAAAACTAACCGCGAACTGCATGCTGAG
CGATGTGATACAGAACTAAAACTCTCTGTATGTGTTTTGTGTTATAAAGAGGCGTTCTTCTTATTTTCTT
AGATACCACGGTCTACATTTTTTAATATGTTAGGCCATTACTGAAACTACACTCTTTCTGCGTTTGTGAA
TAGGTTGCTCGTAAAATGAGAGAGGAGGATGGCTTCTACTATCCTCATAATCTAGATTTCCGTGGTCGTG
CATACCCTATGCATCCACATCTGAGTCACCTAGGTTCAGATCTATGCCGAGGTGTTCTAGAGTATGGTGA
AGGGCGGCCACTCGGAAAATCTGGTTTACGCTGGTTGAAGATACATTTGGCCAACAAATATGGTGGAGGC
ATTGAAAAGCTTACTCATGAGAGCAAACTAGCGTTTGTGGAGGATCGGTTGCCTGCTATATTTGATTCAG
CAGCAAATCCTGTTGATGGGAACTGTTGGTGGATTAATGCCGAGGATTCTTTTCAATGTTTAGCTGCATG
CATAGATCTTTCTGATGCCTTGAAAAGTTCATCACCTCATGCTGCTGTCTCTCACCTACCTATTCATCAG
GTATTGTCTTCGTTGAGAATGAGGCGCTCTCGTGTGGGTGTCAACATTACATAAATCATCACCTGTAAAT
AGACAAATAGAGAAAGGCCAATATCCCAGGATTAAGCAAGGTTAATAACTTAATATAGTATGTGCACTAG
GCATGCTTTTGCAATAGAAGAAGTGCCAATATTGACGCAATAAGTTTCATGATTAGTTGCTTAATGACAC
GCTTCTGTTGGCACATCCACATTCTTGTGCATCTTGTTTTATTTTGGAAATTCAATTAATCAAATGGCAG
CATTTCAGATGCATCTTGTTTTATAAGTAAATATTGCCCATTACAATTAAAATATTGTTGAGTTTGCTGC
AGTATATCTTGTTCAGGCAGCTTCTGTCACTGTTACCCCTTATGTTTAGGAACATTGCAACCACCTATTC
TTGTTAGTTTTTGAATATTCTATTGACTCCTGATCAGGCTGTGCTGGCTTCGCTGTAAATTCTATGCACC
ATCTACTAGTTGACAATGTTTATTTTTCTTACCTTTTAGAGGAAGATCATGCTCCTAATCTAAGTTTTAT
CTCCTGAAGCTTGTGTTTTTGGAGTGGGGCCTAGACTCCTATTGCCCACCATAAATCTTATAAGCGCCGA
ATCTAATAGGAAGAACTAGAGTTTGTTATGTGTAGATGATAATGGGACATTGTTCTACCCTACACAGCGA
TAGGAAATTCTGGACATAGTCATTGCATGGTGCTCTAGTGTTAAGTTATGGTGGCAATTGGTTTGAGATA
TCTCTGCCCAGCCAGCATTTGTCACGAAATTACTAATTACTTGTTACATTTGTCATCTATCAGGATGGTT
CATGCAATGGGTTACAACACTATGCCGCTCTTGGAAGGGACTACGTAAGTTCTCCCTGCTATACCAACTG
AGCATCACTCAGCCTGAACTTCTTTTGTTTTACCCGTGATATGGTAAAATAGAGCCTGCACTTTGTGCTT
GTGTGTAATTATATGGTCAAGTGCACTGTTTTTTTACATAAATTTTGTTTATTGTCTGCAATTTAGCAGT
AATCAACTAGGTCGCAGAACTTCTGTTCTTGTTTGCATGCTATTTTTTCATGAAATTTTATAGTGGAACT
ATCCAGATATAAATACTTGAAAATTGTCTTTGTACAGATGGGCGCGGCAGCTGTCAACTTGGTTCCTGGA
GAGAAACCTGCAGATATCTACTCAGAAATAGCTGCTAGGTGCCGCCCTTCCCCCTCTCTGATTCTTGTAT
GCACTACATTTCGGGTTGTCCCTATTTTCCTCTCAACTCAAGTGTGTGAACAAAAGGATCAACCAACATC
TCTTACATGCTCCATTGTCCAGTTGTTCAAAACAGCTCTGTACATGTCTGGTTTGATTATATTTCTGAGC
TGACTTATGCAGGTTGTTATCTGATAACTGAATCTTATCATGTAGAAACTACTAGAAAATAGATTTTACA
TGTCTTAGGGAAAAATTTCACCTTTAGCATTAAGTCAGCTTTTTTTAGATCAGCTGACAAAATATTTCCT
TCATCAAAACAGAAGCGATGACAATTGTGTATGAAGACAAAAAAGAGTCCATGAATCTATATATTTTGCT
TCTTGAAATAAAAGTAGTTGGCTGTGACTAAGGAACTCTTTTCTGTAACTGCTAAAAAAACTCAACCAAC
AGGTTCTACCAACATCTCATTTTTATTAGAAATAACACTGAGGTAGCCTTGAACCCTGGTGGGCTGGACG
AGTGCTGAGGCTGTCACCATGCTCAGCTCTCCTTTTCCAATTATTAATTTGCCTGAATAGATTATAATAT
TTAGCTTATGTGTCATCTAACGATTAACCAGTTTTTAGACTATTCATTTCATAATGCATTTTCCAGTGCC
AAGTGCACTCAGTTTATTAAATTGATAATGTTTTGGCATAAACATGAATGAAGGGTACTAAATGTTGTAC
GGGAAGACTCGATGAAAGATCCTGCTACCGACCCAAGTGTTCCATTAGCAAGGGTTTTAGTCGATCAGGT
TAGTCTTCTCCCTCCCCCGGTCCGCCTCATTCAAGAAATATTCTTCTTTGTGTACTTTTTTTTTAACAAA
ACAGTTGAGGACCTGGACATTGGTAGCTTACAGGTGGATAGGAAGTTGGTCAAGCAGACTGTGATGACGT
CAGTTTATGGTGTCACATTTATCGGTGCTCGCCAGCAAATTATGAAAAGGCTTCAAGAGAAAGGGCACAT
TACAGATGAGAAATTGCTCTATGATGTGTCCTGCTATGCTGCCAGGGTAAGTACTTTATTTGCATCTGAA
AGACTGGCTTTTTCTAACTCCCCTATCACTGATAAAAAAGGCGCGCCTAGGCTCTAGGCGATAGGAAAAC
ACCTAGAGCTTAATCATGCTAGGCATGCACTTAAGCATGCGCTCACAATTTATGTGTAGCACATTTTTCC
CTTGCCCCCTATTGATTTCATTTGAGAGATAAGGACATGCTGTGACTGTTGAATCTCTGATGAAGGTAAC
TTTGGATGCACTTGGACAAATGTTCCAATCTGCCCGTGGTATAATGGCGTGGCTTGGTGACTGTGCAAAG
GTATATGGTCTGTTTTGAATCATAATTTTCTCAGTTGATTTAAAATTTACAGGCATCCAATTTTAAAGTG
GGGCATTACATTTTCCTTTGTACATGCTTCTTTGGTAGTTGAGTTGAGACATCAAAAGGCTCTTACAGTG
TTTCATTTCTTCATAGATGATTGCTTCAAAAAATCAACCTGTCAGATGGACGAGTCCTGTTGGCCTTCCA
GTTGTTCAGCCGTACAAGAAATATAAAAACTATATGGTGAGTTACTTATTGACTGCATATATGTGCATTT
TTTGTATATCTGCACTGAACAAGCAGTATGCCTGATCCTTGATTTGTGTTGGTTATTCTTGCTCACTTTC
CTTTGAGAGAGCATTCTTACTCATTTGTGCAAATGACATGTTGGTTATGCACCTTTTGAAACATCACTGC
AATGCCAGTTGAAGAACACTATTGGTTCATACATGAAAACAAACATAAGCTAATTGTACTTTGATCTGGA
TCATGTATTTATTTTCTTCATATAATTCTTTCAAAGAAGTGCCCAATGTGTGGAAGGGGCATTTTAGGAA
GGATTGAGACACATTCAAGATAAAATATTAAATTACTTTGACTTTGCCCCTTCATTGCCATTTTATGAAC
ACTATTTGTGTTATTTGTTTCAATATGGTCACCATCGTGCAGATAAGAACTTCTTTGCAATGTCTGGCTT
TACGACGGGAGGGCGATGCAGTAAGTAATACTTTATTCACTTGTTCCGTGCTTATTCCCACTATCATGGT
TAATTTACTGCCATTTAATTTTAGATTGCAACCCAAAGGCAAAAGGCAGCATTTCCACCGAATTTTGTGC
ACTCTCTTGATAGTTCACATATGATGATGACGGCGATTACTTGCAAAGAGGCTGGTCTTCATTTTGCGGG
TATTTTCTGATTTCTGGTTCCATTGCTAGCATAAATATTTTAGTAGCAAACCTCCTCCCAGTACTAACCA
ACCTTAAGCTATTACTACAGTGGAAGTAGAATGAACTGGATTTTTGTCTTTGATGAGTTTGGTCTAATAC
ATTTAACTAAAATTTGACACTGCCTTTAAACTTATCTTTATATCAAAATGTCCATGTTATCCTTTACCAG
ACCTTAGGAAAAATGTTATAATCCCTCTGTCCCAAAATAAGTGACTCAAAAATGACTCAACTTTGTACTA
AGTTAGTGTAAATTGGAGTCATTTTTGAGTCACTTATTTTGGGACGGAGGGAGTACCTGCTACTGGTATG
CATCCCAGCAGCAGGAGCTGCTAACCTTTTACATTTTTGACCGTTCCATGCATTGCCACTGAGGCAAGTG
TTCCGTTCATAGATATCAGATAAGAATAAGCTTGATGTAAAACAAAGTTTCTGGTAAATCATGGATGTCA
GGTTCCTTTTCTTGTTGTTGGGTAATGTGCTATGTTCTACTCCCTCCGTCCCATAATATAAGACGTTATT
ACAATCAATATGTGAGTATATTGGGTGTATTAATGTCTTGTATTATGGGACGGAGGGAGTACATGTTTAT
TCTTGTTAGTGTTCTGTCAGCATTACGAATTGTTGGTTTCAGTATATTTGTGCAAATCGAATAGTGTAGG
ATTTTGCTAAAAGGGGCTCCACAGTCCCCAAATACAACGAGTTGGCCAGAATCTAAGCTCTCTTAAGGGC
ATATGGTGTAATTTTAGTGTGAAAGATAGTCACGATTTCTTTGTATCAAACAGCCAATAAATAATGCAAA
TTAAGTCAAATTTGTACTTCAAAAACTTTTTACTTTCGTTGCTTGTGCTTATGATGTTTGTCCGTAAATA
ATTTATGTTGCCTTTTGTTGACGTGTTTTGGCTGCAGGAGTGCATGACTCATTTTGGGTGCATGCATGTG
ATGTTGATAAAATGAATCAGATCTTGAGGGAGCAATTTGTGGAGCTGTACAGCATGCCAATTCTTGAAAA
TGTATGCTGCCGGACTGCATCAAGTGTCTTTTAAGCAAGCAATACTTTGTTCAACTGTATCAGTAGATTA
TTTCCTAATGCTCTTTCTCTTATATCTTATATTCTATCCAGCTATTGGAAGAGTTTCAGACATTATTTCC
GACAGTAGAGTTTCCTCCCTGCCCAGCCCAAGGGAATTTTGATGTGAGAGAAGTTCTCACATCTACCTAT
TTCTTCAACTAAGCTTACCGGGAGAGATATACTTAACATGTCGTGAGCTCGGCGTGGTTGGATAGCTGAA
TTGCCAGATCACTGTTCACAAATCACAACATGATGGTTGTATGGGGGCCAGTGGCTTGATGGGCCAAGAA
GCTGAGTTTTTCAAAATCTTCGGCGTGAGAAACAATTACAGCAGCAAGCCATTGCAACTCAGTTTGTTGG
CACACACCGGCAACAGAGGCATGAATGGTTTTTCGGCACGGGTTAATCAACTCGCTGGACTCTGAAGCAT
GCGAAATGGTTACAAGATGCCTAAGCTGAACAAGCCTCAAGTGGTTGGTGCTGATGATCTTTTGGTTGAC
GCAAGATCTGTGAGGATGTGAAATTCAGTTCAGGCGCTGGCTACCATTACTCAGGCCAAGAAGGTAAATT
ATGAAATATCAAGCTATCAACTTGTGAAGAGTCCAGTCTTGCTGATGATGCTGATCAATTTTACCATAGA
TGAGAGTTTGAACCCTAATTTTACTGCCTATACGTTTTTTGATCTCTTAGGATTTTTGTAGCCGATGGCT
CTGCATGCGCTGCACCATCGCCCTGTAATAATGTGTAGAATCCGGGCACCAAACAGATACCGAAAAGTGT
ATATGAGATCCATAGATGCTGTTGACAAGAAATAAAATTGTACAGGAGAGAAGTTTTGACTGGACTATTT
CATCAATCTTTGGTTTCCTTGATTGATATTGTGCCGTGAATCATGGGATGTCGACGGCTCAGATATGAAC
ATGTGGTGTTGACTCTTGAGCTACAGCTTTAGAGCATTTCCAGCCGTCCCTTTTTTTTCGGCACCGATGG
ACGGAAAAGTCGGCCTAAATCATTGTTCTGATGTTATCAGAAAACTTTGTCATAAAATGAACTCGATATA
AATGTATTTCACGATTTGACCTTTTCGACAACGTCACAACCCGTGACGTTTCTATTCTATTTGAAAACGC
GGAACCTACATGCATTGCTTCTGTTCTATTTGAAAACGCACGAGCCTACATGCATTGCTCCCCTTCATAG
CTAAATGGGATGTCTAACATCTTGCTGGAAACGTCACATCCCATGGCGTCACCCCCTTGGCGTTTCTAGC
AACGCAGCATATGCTGGCGTTTCTGCCCAGCCACACAGCGTCTTGACCAGGCCAACAACGCATGTAGGTT
CCGCGTTTTCAAATAGAGCAGAAACGTCGTGGCCTATGGTGTTACCAATAGAGTCAAATCGTGAAATAGT
TTTGTCTAATGTTTATTTTGTGCTGTACTTTTTTGAAAAGATCAAAACAGTGAAAAAGTCCAAATAATGT
CTCATTCGCGTCGCCGATGCTTTACTTTTTGTCAGATTTGAGCAAAATTAGAGCCGACCCTCCCAGGCCA
AATCGAGCCGCGCTACTTTCTGCATGCAAATTGTGCACGTCGCCCACCCCTCTTTCTCCTCTCTTTTCTC
GATGCAAAAAAAAGACTCCCGTGGGGCTCAACGGCTGGAGATGCTTTTACTTTCAACATGTCAATGGGAA
GTTCAAACAAATTCTGATCAAATTATTACTCCCTCCGTTCCTAAATATAAGACCTTTTAGATATTGCATT
ATAAACTACATATAGATGTACATAGACATATTCTAAAGTGTAGATTCACTCATTTTGCTCCGTATGTAGT
CTTTTAATGAAATCTCTAAAAGGTCTTATATTTTGAAACGGAGGTAGTATTTTGAACCTAGTTCTGATCG
AGC

Remark
first report describing the addition of a peptide sequence to a protein C-terminus by alternative 3- terminal exons in higher plants.
revised date
2001-12-20