Gene Name
LOB
Gene AC

AB008265

Species
Arabidopsis thaliana (thale cress)
GeneAlias
At5g63090; MDC12.5; LOB domain protein; lateral organ boundaries protein (LOB)
Organism
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicots; Rosidae; eurosids II; Brassicales; Brassicaceae; Arabidopsis.
Length
81662
Exons Number
3
Introns Number
2
AS Type
III+IV+VI+VII
AS factor
As Number
4
PMID
12068116
Fasta Sequence
GGCACCGGCATGTATTCATTAAACTATTATGGTTTTGTTTCCTTGTATATCTCTGAATGTTGGGCCTCAG
TGTTTTCTTCCTTCTTTAAAGTCGTATTTTGTAACTTCTGTAATGGATGTGCAGACAGTTTTGGCAGTCT
GAACTGCTGATCAAGATGCCAGCACTGAGAATGAAGAGGAAGTTTGATGATGACATTTTCGGGAGTGAGT
TTGACATCAAATCCATGAAATCGGTGAAAATCTCGCCTTCCCAAGTTGATGAGTTCGAGCAGGCATTTGT
GTTAAACTCGTCTTACAAGGACCCTCAGGATGGTAAGTGACTGCATGGTTGCTCTTTCAAGAGAAGAGGT
GACTGCATGTGCATGGAATATAGGTGTCTTGTTCTCTTATGACTAAAATATATTGAACGTAGATATTTCC
CTATGTTTCAAATAAGAAACCTTCCAAGTTAGCTCCAATGTCCTTATTGGTTCTCTATGCTGGTGATAAA
TGTGTACCCTTGACTGGAATTTTGACAATTATGTACGAGTATGTCTTTAGCAGTATATTCAGTAGATACT
CATGTAGTCATGTTTCTAAATATTTGGCACTGTATGACCAAATCACACATGTCATGACGTGCCTTCAGTA
AAGTTGAACCATAAAACGCTCTACCAGTATTATAAGCACGACTGTGAATGAATTCTAACATGGGGCAAAG
TTAATAGGTGTATTTGGGGGAAATTTGCCTTGAGATTAGCAGATTGACAAGTGTTGGGGAAAGATATTCG
TTCAATCTTTAAGAAACGGAGGGAGTATTATCTGTAAACTCACAGTAGATAACTAGATTAGTTGGTTGTG
TCTTATTGATTTGTTCACTTTTACATGTAATATTTGTAAACAAAGTAGAGCAATACACTGTGCATGGTTG
ATAATTCAAGGTTAGTGAACCTGTGTATATTTCATATGGATTGATGGTCTCTTTACTTTTTTTCAGAGCC
TGAGCCGATAACTCAACTAGCYGTCCAGGATATTAGGGTTACAGAATTTTCCGGTTTGCATGCTGTACTT
GGAGGAACATCCGTTGCTCTGCTGAAGGTATTGCAACATCATCTGACTCAAATTTGACTCAGTGATAAAA
TATTGTGCACTTATCCTTGTGTTTAATCATTTTTATTTCAATACAAATATCTAGTGTCCTCTTGTATTTC
AACTGCCAAATTATCACATTGCTTCCGTTGTTTGTAATATTACCACTTAGACTACTGTTCGGTACCTGTC
CAAGTTAAATGTTCTTTTGATGTTAGCTTGCCTTACATGTCAATGGATGTTAAATTTCTTTTTGGTTTTC
TTGTTAATATGTTCAGATGATTGCTTTCAACTACTGTTCGGTACCTGGTCAAGTTAAATGTTCTTTTGAT
GTTAGCCTGCCTTGCATCCCAATTGATGGTTTGCCTGACAACAGTAAATGGATGTTAAGTTTCTTTTTGG
TTTTCTTGTTAATATGCTCAGATGATTTCTTTCAGCAAGTTATCATTGTTGATTTCCAAATTCGATGACA
AATGAAAAAGGGTGCAATTTCGAACTAGAACTTTTGATGATGGAATTTACCTGTTGCCTATTGTCATTTC
ACCTTCCACTTAAACTTGTTCAGATTAAATGATTAAATTCTTAAATGCCTCAAATATCTTGTGAAGGCTG
TAGAATGTTGCCATTGTTTGATATTTGCTATTATGATCTGAACTTCGATGTAGCATGTTAAGGTTGGTAG
TACTTTGCTTTGTTACTTTTTTTGGTCATATCTCATGCTTAATTTCTTTCTGAAGTCCCAACACTATATA
TCAGCATCACCATTGTCAGTTTCATTGGAAGAACCTCTGCAACCTAACATTATCATATTGATATATGCAG
GATTTAATATCTGAAACTGTGGTTCCACCAAATTTGGAACCTGATTCTTTATCTAATAATGATGATGGCA
AATCTCAGTCAAATGTAGTGAACACCGGTGATAAAGGTAAGGAGTACCCCTTACCCCTCGAGCAGTTTTT
GTAACTAATGTGGCTAGTTTAGGTGATAAGTTTTTGTTCACGGCCAATGTCTATTTGTCTGCACGTATAA
AAATACACAGCCGCCAAATGCCATGTTTTAGAGAACACATTTGATATGCTCACAAGCAAGGTTTAACCTT
TGCATGTGTATATTCACTTACAATTTGCATTGCAGAGTTTGCAGATGAAGATGTAAATTCTGCAGCACAA
GATATCTGTACTGTCAATGATCATGAGAAAAGCCTGGGCTCAAACCCGGATTGCAGCCTGTTGGATATTT
ATAATCCTGATGATGCTTTTCCTTTCTTATTTGATGTTCCAACTGGTCTCCTGGCTAGCTACAGTACATT
TTGTGATGAATTTGTACCCATCGATTCATTGACAGACATGAGTGGCATATGCGGAGTATTTCCACTTAAT
GAGAGCACCGTGGAAGGTTGCATTGGCAATGAACCATGCCCATCACAAGGGGATATGTGCTTTAATAACT
TTGGTGGGGAGTGCTTTAGCCATTCTGAGGTTTTAGAGTGGTTTAATCCATATATGGATGAGTCTGATGT
ACCTAATCTTATTGGTTATACCGAGTTGAGCTCAGATGCTGCTTGTGTATCTAAAGAGCAAGGGGCCAGG
AAGGTCACTCTTGTGCTTGATTTGGATGGTATGTTGATAGCATGAAAATACTTGCTTTCTTTGGTAACTT
ATTGCTAGCCATTGAGAATAATGTATTGATTCTTCCTGTGCAGAAACCCTTGTTCATTCAACTCTGGAGC
ACTGTGATGATGCAGATTTTTCTTTTCCAGTGTCCTTTGGTCTGAAAGAACATGTGGTATATGTGAGGAA
GAGACCACATTTGCATATGTTCCTCCAGAAGATGGCTGAGATGTTTGACGTTGTTATATTCACAGCCAGC
CAAAGTGTTTATGCAGACCAGCTGCTTGACAGGCTTGATCCAGAGAACACATTGTTCTCGAAGCGTTTTT
TCCGCGAGTCATGTGTATTTACGGAAAGTGGCTACACAAAAGATCTGACTGTTATTGGAGTTGACCTTGC
AAAGGTTGCCATAATTGACAACACTCCGCAGGTAAATTCCTACTATTAAATTTTCAGCACTTCTCTCACT
CGTACTGCCACAGTTGGATTAAAGCTTGCAAAGTGTCCTTAACAAACATTTCTGTTTGGAAGTTTGTCCT
TGATTACCATTACATTTTCTCTTCAAAGCTTTGGCTATTCGTTTCTTATGATACTTATTATGCGTGCTGT
ATACAGGTTTTCCAGTTGCAAGTGAATAATGGTATACCCATAGAGAGCTGGTATAATGACCCCTTTGATG
AGGGATTATCTCAGCTGATTCCATTCCTGGAGACACTTGCTGTTGCTGATGACGTCCGACCCATAATTGC
CAAGAGGTTTGGCAACTAAAAGGATAATGGCTGAGGTTTTCCAGCAGGTGTTAGGAAGAGTTTGTTGGTT
ACTCACATAGAGGGACAAGAACTTACATGACACATTGACCGAGCTAGTTGAGACTTGCCTTTTTCTTAAT
TTTATTTACATGGGTTTCATAGGATCAAGAATTTTGGTGGCAGAGCTATTTCTCGTGAATTGTAAATATC
CTCAAACACTGTTATAGAATTTTGTACATAAAAACTGTTAGAAATGAAAGCGAAACTCTCT

>gi|34481848|emb|AJ507395.1|HVU507395 Hordeum vulgare subsp. vulgare rpoT gene for DNA-directed RNA polymerase, chloroplast precursor, exons 1-19
CAGTCGCGAGGTTGACACAAACTCTCACCGTCAGATACCAGCCCGACGCGATCCAACGGCCACGCGCGCG
CCCTCCCCCCTCCAAACCCCCGATATTTTTTCCCCAAGCCCCCTTATCACCTCCCCCTTCGGTCTCCTCC
CTCCCTCGAAGGTTCTACCGAGGTTTCTCCTCCGCCACCTCCTCCACCCCACCGGCTCCCAATTCCGGCC
GCCGGAGCGCAGCCCCTCGCCGCAGGCGGCGCGCGTATGCCTCTCCTGCTCGCCCCCATCTCCACGTGCG
CGCCCCCGCCGCGCCCCCGCCTGCGCCGCCTCTCGCCGCCGCCGCCCATGGTGGCCGTCGCGCCCGCGCC
CCCGCCCCGCCCCGTCACGCTCCTCCCCATCCTCCCCGCGCCCCCGCCCCTCAACACCGACGCCTTCGAC
TGGCTCGACCTCTTCGCCTTCCTCAACTCCCCCGCCGACTCCTACCAGATCCCCCACCCGCCCCCCTCCC
CCGCCCCGCCGCCGACGGCCGAGGAGGAGCTGGCGGCGCTCCTCGAGAGGGGGAAGGAGCGGGAGCGGGC
GCGGCGGGCGGGCCACCGGCGGCTGCGCCAGCGCCAGGTCAAGGCGGAGACGGAGGCCTGGGCGCGCGCC
GCCGAGGAGTACCGCCAGCTCGAGCGCGAGATGCTCGACCGCAACCTCGCCCCGCAGCTGCCCTACGTCA
AGTCGCTCTTCCTCGGCTGGTTCGAGCCGCTGCGCGACGCCGTCGCCAGGGACCAGGACGTGCAGCGCCG
CAAGCGGGTCAAGCACGTCTACGCCAAGTACCTGCTCCTGCTCCCGCCCGAGAAGGTCGCCGTCATCGTC
ATGCACAAGATGATGGGCCTCCTCATGTCCAGCAAGGACGGCTGCGGCAGCGTCCGCGTCGTCCAGGCCG
CGCACTCCATCGGCGAGGCCGTCGAGCGCGAGGTTTGTTATTCATGGCCCGCTTCTAAGCGCGCTTTCAT
GGCAGACAATATTTTTCCGATATACTATACTGTATCTATTTGTATGACTTAGAAATAGCTCGTTTACCAC
AATGTGAGATTTAGACTTAGTGGTGGGTGACATTAGTGTAATTAATGTAGATAGATGGACTGTAGGCGCT
GTTGTGCAGGGCTTTCACTTCCTTGTGCTTTCCATCTGACTGGCAAACAATTTGACTTGATCGAAAGTGC
CCAATGAGAAATTTGGCAATGTAATGAAGTTAACAAATTGGAGGAACTGAGGACATTATGGAACTGGTTA
GAATATTTTTATCTCCAAATTGTGTCGTGGTGGGATAGCTGGATGAAGTTGTTGACCTACTTTGTTTATT
AAGATCCAATAGATACATCTTGTGAGCTGGTCACCAAGCGGCGATGGCATCTATGTTGCCTGTTTCACAA
TAGGTTTTCTGGCACTGACCATGTGACATGATGTCAGATTGCCAGATCGGAAATCATGTGCGCTAGATTT
GTATTATATTTATGGATGACAAAGCCTTTGATTAGGGATTCATCTTCCTCTGGCTCAGGCCTCGGCTGTT
CTTCTTGTGCGCTAGAGGTGTATATGTTGTAAATGACTGGAGTTTGATCACGTTCATTAGGATGAACTTG
ATGCTATTATAGGTTCTTCACTTTGCCATTTCAGTTGTCACCACACAGTGTTCCCTTAGTGGCAATTGAT
TTTTCTGTGTTTTGAAAGCTATCTATTGTTCTGCAGTACAAAGTCCAGGCTTTCTTTCAGAAGACTAGGA
GAAAAACTAGGAGCAAAAATGAAAGTGAAAATGATCCAGCATTAGACAAGGAGCAGGCAAAATGCCGGAA
ACTTGTTAAGAGCTTGGTGAGGAGACGAAAATTGACTGAAGCACAGAAGCTTGTGCAACAAGAGATTGAA
TTGGAGGAATGGGGTGCAGAAGCCCAAGTGAAGGTTTGTTTCCGGATAGCATACCTACAAGTATAGAATT
TTCTCTAATGTGTTATGAAAGATGATCCTCCTTTTGTGACTGCAGCTAGGAACTCGCCTGATTGAATTGT
TATTGGATTCAGCATTTGTGCAGTCACCAGCCAACCAAACACCAGACAATTCTCCTGATTTTCGACCGGC
ATTTAAGCATGTATTGCGAAAGCCTATTGTAGAAAATGGGTAGGGCTGCACATTTTCCCAGTGTTTGCCT
TTGTTGCATGCTTTGTGTTCGCACTGACATGTACTGTTGTGTCAGTATCATCTGCTTGCTTAGATTGGGT
AGATCTATTCTGACATTTCTCCTCAATGAGCAGGAGACTAAAGAAGAAGCACTTCGTGATAGAGTGTGAT
CCTCTTGTGCATGAGGGGTTTGAAAGCACTGTAAGCTTGTGTTGCACCGCTATGCTGTTCTTTTCTGGAT
GAATATATACGTTTGACCTTTAAAAAATGGTCATCCAGTTGTTTTCCTCCCTTATAATCTGGATTTTCTC
AAGTGTCAACCCATCGAGTTTGTTGAAACATTTACTTGCAGTGCTCGATGCATTGCAGATTCCATTTTCT
TGTTTTTTATTTGTTCAATGGAAATGCTTCACACACATTTAGAAGTTTGAATTTCTTGCAGGCCAGACAC
GTGGAAATACCCTATCTCCCTATGCTGGTACCTCCTACAAAATGGAAGGGGTATGCTAGTGATTCGTGCA
GTTGTTCTTTTTCAGTTAATTATGTTGGGTATTTGCTATCTTATCAATATTTGAAGTAGCGATTTGCAGT
TAATTAGATGATATAATTGATCGCATCTTCTGTCCGATGATCATTTGCCAACCATGTATTGTTTCAGCTA
TGATAAAGGTGGACACCTTTTTCTTCCTTCATATGTTATGCGGACACACGGTGTGAAGGATCAGAAGGAA
GCCATTAAGAGTGTTCCAAGAAAACAGCTGCGAAAAGTATTCGAGGTTTGCTGACCACCCATCTTTGATG
CAGCCTGCATTTATATTCTTATAAACTTGTTTCCCTTGGCACAGCGGCACATCATCAACACTTCGTATAA
GTTCTCTATTGCTGTAGTGAGTTTTAGTTTCATAACAGCATGTTCTAGATATTCTTCCTGCTTTAATGAT
TATTTCTGATGTTTATTCATTTGTGCTTGCTTAATTTTTATTGAATGAAAGCAGTCTTAAGCATTGTCAT
ATTGCAGGCATTAGATATCCTTGGGGGTACTAAATGGAGAGTGAATAGAAGAGTACATGACGTTGTTGAG
ACTATTTGGAGTCGTGGTGGGGGGATTGCAGGACTTGTTGATAAGGAAAATGTGAGTCAACTGCATATGG
TCAATTATGACATTGTAAATACTTTGTTTCTTTCCATTTTTCATAGAACGCTCTAGTGGCCACACATGTT
TTTCACTACATGTTTGCGCTTTGTTTTGTGTATAGATTCCTCTACCTGAACGACCTGAAACAGAGGACCC
AGATGAAATCCAGAAATGGAGGTGGAGCGTAAAGAAGACAAAGAAAACTAACCGCGAACTGCATGCTGAG
CGATGTGATACAGAACTAAAACTCTCTGTATGTGTTTTGTGTTATAAAGAGGCGTTCTTCTTATTTTCTT
AGATACCACGGTCTACATTTTTTAATATGTTAGGCCATTACTGAAACTACACTCTTTCTGCGTTTGTGAA
TAGGTTGCTCGTAAAATGAGAGAGGAGGATGGCTTCTACTATCCTCATAATCTAGATTTCCGTGGTCGTG
CATACCCTATGCATCCACATCTGAGTCACCTAGGTTCAGATCTATGCCGAGGTGTTCTAGAGTATGGTGA
AGGGCGGCCACTCGGAAAATCTGGTTTACGCTGGTTGAAGATACATTTGGCCAACAAATATGGTGGAGGC
ATTGAAAAGCTTACTCATGAGAGCAAACTAGCGTTTGTGGAGGATCGGTTGCCTGCTATATTTGATTCAG
CAGCAAATCCTGTTGATGGGAACTGTTGGTGGATTAATGCCGAGGATTCTTTTCAATGTTTAGCTGCATG
CATAGATCTTTCTGATGCCTTGAAAAGTTCATCACCTCATGCTGCTGTCTCTCACCTACCTATTCATCAG
GTATTGTCTTCGTTGAGAATGAGGCGCTCTCGTGTGGGTGTCAACATTACATAAATCATCACCTGTAAAT
AGACAAATAGAGAAAGGCCAATATCCCAGGATTAAGCAAGGTTAATAACTTAATATAGTATGTGCACTAG
GCATGCTTTTGCAATAGAAGAAGTGCCAATATTGACGCAATAAGTTTCATGATTAGTTGCTTAATGACAC
GCTTCTGTTGGCACATCCACATTCTTGTGCATCTTGTTTTATTTTGGAAATTCAATTAATCAAATGGCAG
CATTTCAGATGCATCTTGTTTTATAAGTAAATATTGCCCATTACAATTAAAATATTGTTGAGTTTGCTGC
AGTATATCTTGTTCAGGCAGCTTCTGTCACTGTTACCCCTTATGTTTAGGAACATTGCAACCACCTATTC
TTGTTAGTTTTTGAATATTCTATTGACTCCTGATCAGGCTGTGCTGGCTTCGCTGTAAATTCTATGCACC
ATCTACTAGTTGACAATGTTTATTTTTCTTACCTTTTAGAGGAAGATCATGCTCCTAATCTAAGTTTTAT
CTCCTGAAGCTTGTGTTTTTGGAGTGGGGCCTAGACTCCTATTGCCCACCATAAATCTTATAAGCGCCGA
ATCTAATAGGAAGAACTAGAGTTTGTTATGTGTAGATGATAATGGGACATTGTTCTACCCTACACAGCGA
TAGGAAATTCTGGACATAGTCATTGCATGGTGCTCTAGTGTTAAGTTATGGTGGCAATTGGTTTGAGATA
TCTCTGCCCAGCCAGCATTTGTCACGAAATTACTAATTACTTGTTACATTTGTCATCTATCAGGATGGTT
CATGCAATGGGTTACAACACTATGCCGCTCTTGGAAGGGACTACGTAAGTTCTCCCTGCTATACCAACTG
AGCATCACTCAGCCTGAACTTCTTTTGTTTTACCCGTGATATGGTAAAATAGAGCCTGCACTTTGTGCTT
GTGTGTAATTATATGGTCAAGTGCACTGTTTTTTTACATAAATTTTGTTTATTGTCTGCAATTTAGCAGT
AATCAACTAGGTCGCAGAACTTCTGTTCTTGTTTGCATGCTATTTTTTCATGAAATTTTATAGTGGAACT
ATCCAGATATAAATACTTGAAAATTGTCTTTGTACAGATGGGCGCGGCAGCTGTCAACTTGGTTCCTGGA
GAGAAACCTGCAGATATCTACTCAGAAATAGCTGCTAGGTGCCGCCCTTCCCCCTCTCTGATTCTTGTAT
GCACTACATTTCGGGTTGTCCCTATTTTCCTCTCAACTCAAGTGTGTGAACAAAAGGATCAACCAACATC
TCTTACATGCTCCATTGTCCAGTTGTTCAAAACAGCTCTGTACATGTCTGGTTTGATTATATTTCTGAGC
TGACTTATGCAGGTTGTTATCTGATAACTGAATCTTATCATGTAGAAACTACTAGAAAATAGATTTTACA
TGTCTTAGGGAAAAATTTCACCTTTAGCATTAAGTCAGCTTTTTTTAGATCAGCTGACAAAATATTTCCT
TCATCAAAACAGAAGCGATGACAATTGTGTATGAAGACAAAAAAGAGTCCATGAATCTATATATTTTGCT
TCTTGAAATAAAAGTAGTTGGCTGTGACTAAGGAACTCTTTTCTGTAACTGCTAAAAAAACTCAACCAAC
AGGTTCTACCAACATCTCATTTTTATTAGAAATAACACTGAGGTAGCCTTGAACCCTGGTGGGCTGGACG
AGTGCTGAGGCTGTCACCATGCTCAGCTCTCCTTTTCCAATTATTAATTTGCCTGAATAGATTATAATAT
TTAGCTTATGTGTCATCTAACGATTAACCAGTTTTTAGACTATTCATTTCATAATGCATTTTCCAGTGCC
AAGTGCACTCAGTTTATTAAATTGATAATGTTTTGGCATAAACATGAATGAAGGGTACTAAATGTTGTAC
GGGAAGACTCGATGAAAGATCCTGCTACCGACCCAAGTGTTCCATTAGCAAGGGTTTTAGTCGATCAGGT
TAGTCTTCTCCCTCCCCCGGTCCGCCTCATTCAAGAAATATTCTTCTTTGTGTACTTTTTTTTTAACAAA
ACAGTTGAGGACCTGGACATTGGTAGCTTACAGGTGGATAGGAAGTTGGTCAAGCAGACTGTGATGACGT
CAGTTTATGGTGTCACATTTATCGGTGCTCGCCAGCAAATTATGAAAAGGCTTCAAGAGAAAGGGCACAT
TACAGATGAGAAATTGCTCTATGATGTGTCCTGCTATGCTGCCAGGGTAAGTACTTTATTTGCATCTGAA
AGACTGGCTTTTTCTAACTCCCCTATCACTGATAAAAAAGGCGCGCCTAGGCTCTAGGCGATAGGAAAAC
ACCTAGAGCTTAATCATGCTAGGCATGCACTTAAGCATGCGCTCACAATTTATGTGTAGCACATTTTTCC
CTTGCCCCCTATTGATTTCATTTGAGAGATAAGGACATGCTGTGACTGTTGAATCTCTGATGAAGGTAAC
TTTGGATGCACTTGGACAAATGTTCCAATCTGCCCGTGGTATAATGGCGTGGCTTGGTGACTGTGCAAAG
GTATATGGTCTGTTTTGAATCATAATTTTCTCAGTTGATTTAAAATTTACAGGCATCCAATTTTAAAGTG
GGGCATTACATTTTCCTTTGTACATGCTTCTTTGGTAGTTGAGTTGAGACATCAAAAGGCTCTTACAGTG
TTTCATTTCTTCATAGATGATTGCTTCAAAAAATCAACCTGTCAGATGGACGAGTCCTGTTGGCCTTCCA
GTTGTTCAGCCGTACAAGAAATATAAAAACTATATGGTGAGTTACTTATTGACTGCATATATGTGCATTT
TTTGTATATCTGCACTGAACAAGCAGTATGCCTGATCCTTGATTTGTGTTGGTTATTCTTGCTCACTTTC
CTTTGAGAGAGCATTCTTACTCATTTGTGCAAATGACATGTTGGTTATGCACCTTTTGAAACATCACTGC
AATGCCAGTTGAAGAACACTATTGGTTCATACATGAAAACAAACATAAGCTAATTGTACTTTGATCTGGA
TCATGTATTTATTTTCTTCATATAATTCTTTCAAAGAAGTGCCCAATGTGTGGAAGGGGCATTTTAGGAA
GGATTGAGACACATTCAAGATAAAATATTAAATTACTTTGACTTTGCCCCTTCATTGCCATTTTATGAAC
ACTATTTGTGTTATTTGTTTCAATATGGTCACCATCGTGCAGATAAGAACTTCTTTGCAATGTCTGGCTT
TACGACGGGAGGGCGATGCAGTAAGTAATACTTTATTCACTTGTTCCGTGCTTATTCCCACTATCATGGT
TAATTTACTGCCATTTAATTTTAGATTGCAACCCAAAGGCAAAAGGCAGCATTTCCACCGAATTTTGTGC
ACTCTCTTGATAGTTCACATATGATGATGACGGCGATTACTTGCAAAGAGGCTGGTCTTCATTTTGCGGG
TATTTTCTGATTTCTGGTTCCATTGCTAGCATAAATATTTTAGTAGCAAACCTCCTCCCAGTACTAACCA
ACCTTAAGCTATTACTACAGTGGAAGTAGAATGAACTGGATTTTTGTCTTTGATGAGTTTGGTCTAATAC
ATTTAACTAAAATTTGACACTGCCTTTAAACTTATCTTTATATCAAAATGTCCATGTTATCCTTTACCAG
ACCTTAGGAAAAATGTTATAATCCCTCTGTCCCAAAATAAGTGACTCAAAAATGACTCAACTTTGTACTA
AGTTAGTGTAAATTGGAGTCATTTTTGAGTCACTTATTTTGGGACGGAGGGAGTACCTGCTACTGGTATG
CATCCCAGCAGCAGGAGCTGCTAACCTTTTACATTTTTGACCGTTCCATGCATTGCCACTGAGGCAAGTG
TTCCGTTCATAGATATCAGATAAGAATAAGCTTGATGTAAAACAAAGTTTCTGGTAAATCATGGATGTCA
GGTTCCTTTTCTTGTTGTTGGGTAATGTGCTATGTTCTACTCCCTCCGTCCCATAATATAAGACGTTATT
ACAATCAATATGTGAGTATATTGGGTGTATTAATGTCTTGTATTATGGGACGGAGGGAGTACATGTTTAT
TCTTGTTAGTGTTCTGTCAGCATTACGAATTGTTGGTTTCAGTATATTTGTGCAAATCGAATAGTGTAGG
ATTTTGCTAAAAGGGGCTCCACAGTCCCCAAATACAACGAGTTGGCCAGAATCTAAGCTCTCTTAAGGGC
ATATGGTGTAATTTTAGTGTGAAAGATAGTCACGATTTCTTTGTATCAAACAGCCAATAAATAATGCAAA
TTAAGTCAAATTTGTACTTCAAAAACTTTTTACTTTCGTTGCTTGTGCTTATGATGTTTGTCCGTAAATA
ATTTATGTTGCCTTTTGTTGACGTGTTTTGGCTGCAGGAGTGCATGACTCATTTTGGGTGCATGCATGTG
ATGTTGATAAAATGAATCAGATCTTGAGGGAGCAATTTGTGGAGCTGTACAGCATGCCAATTCTTGAAAA
TGTATGCTGCCGGACTGCATCAAGTGTCTTTTAAGCAAGCAATACTTTGTTCAACTGTATCAGTAGATTA
TTTCCTAATGCTCTTTCTCTTATATCTTATATTCTATCCAGCTATTGGAAGAGTTTCAGACATTATTTCC
GACAGTAGAGTTTCCTCCCTGCCCAGCCCAAGGGAATTTTGATGTGAGAGAAGTTCTCACATCTACCTAT
TTCTTCAACTAAGCTTACCGGGAGAGATATACTTAACATGTCGTGAGCTCGGCGTGGTTGGATAGCTGAA
TTGCCAGATCACTGTTCACAAATCACAACATGATGGTTGTATGGGGGCCAGTGGCTTGATGGGCCAAGAA
GCTGAGTTTTTCAAAATCTTCGGCGTGAGAAACAATTACAGCAGCAAGCCATTGCAACTCAGTTTGTTGG
CACACACCGGCAACAGAGGCATGAATGGTTTTTCGGCACGGGTTAATCAACTCGCTGGACTCTGAAGCAT
GCGAAATGGTTACAAGATGCCTAAGCTGAACAAGCCTCAAGTGGTTGGTGCTGATGATCTTTTGGTTGAC
GCAAGATCTGTGAGGATGTGAAATTCAGTTCAGGCGCTGGCTACCATTACTCAGGCCAAGAAGGTAAATT
ATGAAATATCAAGCTATCAACTTGTGAAGAGTCCAGTCTTGCTGATGATGCTGATCAATTTTACCATAGA
TGAGAGTTTGAACCCTAATTTTACTGCCTATACGTTTTTTGATCTCTTAGGATTTTTGTAGCCGATGGCT
CTGCATGCGCTGCACCATCGCCCTGTAATAATGTGTAGAATCCGGGCACCAAACAGATACCGAAAAGTGT
ATATGAGATCCATAGATGCTGTTGACAAGAAATAAAATTGTACAGGAGAGAAGTTTTGACTGGACTATTT
CATCAATCTTTGGTTTCCTTGATTGATATTGTGCCGTGAATCATGGGATGTCGACGGCTCAGATATGAAC
ATGTGGTGTTGACTCTTGAGCTACAGCTTTAGAGCATTTCCAGCCGTCCCTTTTTTTTCGGCACCGATGG
ACGGAAAAGTCGGCCTAAATCATTGTTCTGATGTTATCAGAAAACTTTGTCATAAAATGAACTCGATATA
AATGTATTTCACGATTTGACCTTTTCGACAACGTCACAACCCGTGACGTTTCTATTCTATTTGAAAACGC
GGAACCTACATGCATTGCTTCTGTTCTATTTGAAAACGCACGAGCCTACATGCATTGCTCCCCTTCATAG
CTAAATGGGATGTCTAACATCTTGCTGGAAACGTCACATCCCATGGCGTCACCCCCTTGGCGTTTCTAGC
AACGCAGCATATGCTGGCGTTTCTGCCCAGCCACACAGCGTCTTGACCAGGCCAACAACGCATGTAGGTT
CCGCGTTTTCAAATAGAGCAGAAACGTCGTGGCCTATGGTGTTACCAATAGAGTCAAATCGTGAAATAGT
TTTGTCTAATGTTTATTTTGTGCTGTACTTTTTTGAAAAGATCAAAACAGTGAAAAAGTCCAAATAATGT
CTCATTCGCGTCGCCGATGCTTTACTTTTTGTCAGATTTGAGCAAAATTAGAGCCGACCCTCCCAGGCCA
AATCGAGCCGCGCTACTTTCTGCATGCAAATTGTGCACGTCGCCCACCCCTCTTTCTCCTCTCTTTTCTC
GATGCAAAAAAAAGACTCCCGTGGGGCTCAACGGCTGGAGATGCTTTTACTTTCAACATGTCAATGGGAA
GTTCAAACAAATTCTGATCAAATTATTACTCCCTCCGTTCCTAAATATAAGACCTTTTAGATATTGCATT
ATAAACTACATATAGATGTACATAGACATATTCTAAAGTGTAGATTCACTCATTTTGCTCCGTATGTAGT
CTTTTAATGAAATCTCTAAAAGGTCTTATATTTTGAAACGGAGGTAGTATTTTGAACCTAGTTCTGATCG
AGC

Remark
revised date
2000-12-27